gys2

Ensembl ID:
ENSDARG00000004904
ZFIN ID:
ZDB-GENE-030826-31
Description:
glycogen [Source:RefSeq peptide;Acc:NP_001018199]
Human Orthologue:
GYS2
Human Description:
glycogen synthase 2 (liver) [Source:HGNC Symbol;Acc:4707]
Mouse Orthologue:
Gys2
Mouse Description:
glycogen synthase 2 Gene [Source:MGI Symbol;Acc:MGI:2385254]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20248 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20248
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014007 Nonsense 610 701 15 16
Genomic Location (Zv9):
Chromosome 4 (position 15870919)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16813759
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTTAATGTGGTAAAGTGTTTCTTTCTGCTCAGTTCTACATGCACGCC[A/T]GACATTTGGCCCTCAGCAGATCCTTCCCTGAGAAATTCCGACCGGAGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link