lonp2

Ensembl ID:
ENSDARG00000004896
ZFIN ID:
ZDB-GENE-041212-1
Description:
Lon protease homolog 2, peroxisomal [Source:UniProtKB/Swiss-Prot;Acc:Q5PQY6]
Human Orthologue:
LONP2
Human Description:
lon peptidase 2, peroxisomal [Source:HGNC Symbol;Acc:20598]
Mouse Orthologue:
Lonp2
Mouse Description:
lon peptidase 2, peroxisomal Gene [Source:MGI Symbol;Acc:MGI:1914137]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13813 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13813
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027791 Nonsense 565 840 11 15
ENSDART00000028806 Nonsense 565 840 11 15
Genomic Location:
Chromosome 18 (position 18153799)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTGCGTGTGTKTGCAGGTACACACGGGARGCTGGCGTTCGCTCTCTG[G/T]AGAGGAAGATCGGGGCTGTCTGTCGAGCYGTGGCTGTGAAGGTTGCTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m7h7vmjw