lonp2

Ensembl ID:
ENSDARG00000004896
ZFIN ID:
ZDB-GENE-041212-1
Description:
Lon protease homolog 2, peroxisomal [Source:UniProtKB/Swiss-Prot;Acc:Q5PQY6]
Human Orthologue:
LONP2
Human Description:
lon peptidase 2, peroxisomal [Source:HGNC Symbol;Acc:20598]
Mouse Orthologue:
Lonp2
Mouse Description:
lon peptidase 2, peroxisomal Gene [Source:MGI Symbol;Acc:MGI:1914137]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36621 Essential Splice Site Mutation detected in F1 DNA During 2016
sa13813 Nonsense Available for shipment Available now
sa29014 Nonsense Mutation detected in F1 DNA Unknown

Mutation Details

Allele Name:
sa36621
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027791   None 840 None 15
ENSDART00000028806 Essential Splice Site 241 840 4 15
Genomic Location (Zv9):
Chromosome 18 (position 18300397)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 18528979
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGTTGCTTCAAAAGACCCGCAAACTCAGACCGGATGATGACAAAAGAG[T/C]AGGACAACATAAAAATTAGCACAGACAAACTCATCCACAGCTTCCTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13813
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027791 Nonsense 565 840 11 15
ENSDART00000028806 Nonsense 565 840 11 15
Genomic Location (Zv9):
Chromosome 18 (position 18153799)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 18505565
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTGCGTGTGTKTGCAGGTACACACGGGARGCTGGCGTTCGCTCTCTG[G/T]AGAGGAAGATCGGGGCTGTCTGTCGAGCYGTGGCTGTGAAGGTTGCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29014
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027791 Nonsense 614 840 12 15
ENSDART00000028806 Nonsense 614 840 12 15
Genomic Location (Zv9):
Chromosome 18 (position 18146595)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 18498361
KASP Assay ID:
2261-2064.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGAATACAGACAGTAAGGTGGAGGATTCTGGGATTGCAGCACCTCCT[G/T]AAATGCCAATTGTCATTGACCACATTGCCCTGAAGGATATTCTTGGACCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link