acsm3

Ensembl ID:
ENSDARG00000004880
ZFIN ID:
ZDB-GENE-080220-22
Description:
acyl-coenzyme A synthetase ACSM3, mitochondrial [Source:RefSeq peptide;Acc:NP_001104706]
Human Orthologue:
ACSM3
Human Description:
acyl-CoA synthetase medium-chain family member 3 [Source:HGNC Symbol;Acc:10522]
Mouse Orthologue:
Acsm3
Mouse Description:
acyl-CoA synthetase medium-chain family member 3 Gene [Source:MGI Symbol;Acc:MGI:99538]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9805 Essential Splice Site Available for shipment Available now
sa11987 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9805
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041806 Essential Splice Site 343 591 7 13
Genomic Location:
Chromosome 2 (position 44795183)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATCAGCMCAGCTTATCTTAATCTAATMCTCATTTTTGTRATTTTTACC[A/T]GGTATAAATTCCAGGCTCTTRAACACTGTCTGTGTGCCGGAGAGCCCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11987
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041806 Essential Splice Site 521 591 11 13
Genomic Location:
Chromosome 2 (position 44790870)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAGCTGAATCAGCCRTAGTCAGCAGCCCYGATCCKGTTCGAGGAGAGG[T/C]AACGWTGTGCATTCTRGGATTGCCTTCTTTATGAAGGATACAAGTATGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vwgt8ee1