rock2b

Ensembl ID:
ENSDARG00000004877
ZFIN ID:
ZDB-GENE-060125-2
Description:
rho-associated, coiled-coil containing protein kinase 2b [Source:RefSeq peptide;Acc:NP_001087216]
Human Orthologues:
ROCK1, ROCK2
Human Descriptions:
Rho-associated, coiled-coil containing protein kinase 1 [Source:HGNC Symbol;Acc:10251]
Rho-associated, coiled-coil containing protein kinase 2 [Source:HGNC Symbol;Acc:10252]
Mouse Orthologues:
Rock1, Rock2
Mouse Descriptions:
Rho-associated coiled-coil containing protein kinase 1 Gene [Source:MGI Symbol;Acc:MGI:107927]
Rho-associated coiled-coil containing protein kinase 2 Gene [Source:MGI Symbol;Acc:MGI:107926]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23749 Nonsense Mutation detected in F1 DNA During 2014
sa23748 Nonsense Mutation detected in F1 DNA During 2014
sa17708 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23749
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002777 Nonsense 277 1387 6 34
ENSDART00000097823 None None 264 None 6
ENSDART00000137837 Nonsense 271 1401 6 31
ENSDART00000147168 None None 245 None 6
Genomic Location:
Chromosome 20 (position 33711175)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTATTACGGTCGCGAGTGTGACTGGTGGTCTGTTGGTGTTTTTATTTA[T/A]GAGCTTCTAGTGGGTGAGTAGTGTCAGCTTCATATGCATCTCTTGTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23748
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002777 Nonsense 506 1387 13 34
ENSDART00000097823 None None 264 None 6
ENSDART00000137837 Nonsense 500 1401 13 31
ENSDART00000147168 Nonsense 200 245 5 6
Genomic Location:
Chromosome 20 (position 33694606)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGAAGACAACCTGAGATCCCTGGAGAAAGAGAAAGTTTTACTGAAACAC[C/T]AGCGTACACAGAGCGTAAGAAAAGCTGGTCTAGAGACCGACAGAAAACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17708
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002777 Nonsense 627 1387 15 34
ENSDART00000097823 None None 264 None 6
ENSDART00000137837 Nonsense 621 1401 15 31
ENSDART00000147168 None None 245 None 6
Genomic Location:
Chromosome 20 (position 33693285)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGGAGCAGGACAAACTCAGCCTGCAGACCTCGCTRGAGCTRGAGAAA[C/T]GAGAGARAAACGCCGGCTCAGAGACCATCACTGACCTGCAGGGTGAGCAK
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3trb8l3i