psen1

Ensembl ID:
ENSDARG00000004870
ZFIN ID:
ZDB-GENE-991119-4
Description:
Presenilin-1 [Source:UniProtKB/Swiss-Prot;Acc:Q9W6T7]
Human Orthologue:
PSEN1
Human Description:
presenilin 1 [Source:HGNC Symbol;Acc:9508]
Mouse Orthologue:
Psen1
Mouse Description:
presenilin 1 Gene [Source:MGI Symbol;Acc:MGI:1202717]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30700 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43013 Essential Splice Site Mutation detected in F1 DNA During 2017
hu2548 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30700
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033514 Essential Splice Site 12 456 2 11
Genomic Location (Zv9):
Chromosome 17 (position 51747276)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51133386
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCACAGTTCCGATGGCTGATTTAGTGCAGAATGCTGCCAATAATGTGG[T/A]AAGTTTGCTTATTCCGACCAGGGTTATTGTAGTTCACGAAACCATAAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43013
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033514 Essential Splice Site 279 456 7 11
Genomic Location (Zv9):
Chromosome 17 (position 51738734)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51124844
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCTCAAGAGAGGAATGAGGCCATTTTCCCAGCGCTCATCTACTCCTG[T/C]AAGAAAAACCCCTCAGCACTTCCATCTTCTCAGACTGTGAATGTCCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu2548
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033514 Nonsense 408 456 11 11
Genomic Location (Zv9):
Chromosome 17 (position 51732154)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51118264
KASP Assay ID:
554-0034.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACAATCAACTCAAAACCCTCTTGGCTTTGTTTCTCCTCAGGGTTTATG[T/A]CTGACTCTCCTCCTGCTGGCCATCTTCAAGAAGGCTCTTCCCGCACTCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link