penkl

Ensembl ID:
ENSDARG00000004869
ZFIN ID:
ZDB-GENE-030729-31
Description:
proenkephalin-A [Source:RefSeq peptide;Acc:NP_956377]
Human Orthologue:
PENK
Human Description:
proenkephalin [Source:HGNC Symbol;Acc:8831]
Mouse Orthologue:
Penk
Mouse Description:
preproenkephalin Gene [Source:MGI Symbol;Acc:MGI:104629]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38315 Nonsense Mutation detected in F1 DNA During 2017
sa14975 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38315
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027102 Nonsense 5 234 2 3
ENSDART00000142013 Nonsense 8 237 2 3
Genomic Location (Zv9):
Chromosome 2 (position 11303652)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11728748
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGTTAAATGTTCGTTTTTGTAGCTCATGGCGTTAATGATGAACTCCTG[G/A]TGGACTGTGGCTTTGAGCGCCTGTCTCGTGCTCATGGTTCGGGCTGAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14975
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027102 Nonsense 88 234 3 3
ENSDART00000142013 Nonsense 91 237 3 3
Genomic Location (Zv9):
Chromosome 2 (position 11300959)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11726055
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATCGACAGCCTCAAGCAAGATGAAGAGAGTGCMAACCATGTTCTCGCC[A/T]AGAAATATGGTGGCTTCATGAAGCGTTACGGCGGCTTTATGATTAAAAAR
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link