fam63a

Ensembl ID:
ENSDARG00000004866
ZFIN ID:
ZDB-GENE-070717-2
Description:
Protein FAM63A [Source:UniProtKB/Swiss-Prot;Acc:A3KQS4]
Human Orthologue:
FAM63A
Human Description:
family with sequence similarity 63, member A [Source:HGNC Symbol;Acc:25648]
Mouse Orthologue:
Fam63a
Mouse Description:
family with sequence similarity 63, member A Gene [Source:MGI Symbol;Acc:MGI:1922257]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23440 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23440
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026282 Nonsense 477 520 8 9
ENSDART00000136502 Nonsense 477 520 10 11
ENSDART00000147491 Nonsense 477 520 9 10
Genomic Location:
Chromosome 19 (position 8099391)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACCTCTGAGTGATCTGGAGCTGGCCAGACAACTGCAGCAGGAGGAGTA[T/A]CAGCAGCCACAAACACAACAGCAGCAGCAGCAGCAACCTTCAGCAGGACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hy4nfkkt