esrrga

Ensembl ID:
ENSDARG00000004861
ZFIN ID:
ZDB-GENE-030821-2
Description:
estrogen-related receptor gamma [Source:RefSeq peptide;Acc:NP_998119]
Human Orthologue:
ESRRG
Human Description:
estrogen-related receptor gamma [Source:HGNC Symbol;Acc:3474]
Mouse Orthologue:
Esrrg
Mouse Description:
estrogen-related receptor gamma Gene [Source:MGI Symbol;Acc:MGI:1347056]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32156 Nonsense Available for shipment Available now
sa7438 Missense Mutation detected in F1 DNA During 2016
sa23108 Missense, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32156
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009104   None 435 None 7
ENSDART00000126966 Nonsense 19 508 1 8
Genomic Location (Zv9):
Chromosome 17 (position 29961046)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29884973
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCGGTAGAACTTTCGCTCCCTGAGTGTTTTTCCCTGCACTCCGATCAA[C/T]AGTAGGTACATTTTCATTTCTTCTACTTCTTGCTTGCACTTGTGTGTCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7438
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009104 Missense 152 435 3 7
ENSDART00000126966 Missense 218 508 4 8
Genomic Location (Zv9):
Chromosome 17 (position 29932336)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29856263
KASP Assay ID:
554-4274.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAACATCGAGTACAGCTGCCCCGCCACCAATGAATGTGAGWTCACCAAA[C/T]GTAGAAGGAAGTCCTGCCAAGCCTGCCGCTTCATGAAGTGTCTGACCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23108
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009104 Nonsense 211 435 5 7
ENSDART00000126966 Missense 284 508 6 8
Genomic Location (Zv9):
Chromosome 17 (position 29895687)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29819614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTCTCCCCTCGGTGTTCAAATACAGTCCCCTTTGGCTGCCTTGCAGA[T/A]AACAAGATTGTGTCTCACTTGCTGGTGGCGGAGCCGGAGAAGATCTACGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link