hinfp

Ensembl ID:
ENSDARG00000004851
ZFIN ID:
ZDB-GENE-040426-2764
Description:
histone H4 transcription factor [Source:RefSeq peptide;Acc:NP_998589]
Human Orthologue:
HINFP
Human Description:
histone H4 transcription factor [Source:HGNC Symbol;Acc:17850]
Mouse Orthologue:
Hinfp
Mouse Description:
histone H4 transcription factor Gene [Source:MGI Symbol;Acc:MGI:2429620]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14918 Nonsense Available for shipment Available now
sa33629 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14918
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051414 Nonsense 247 487 6 9
ENSDART00000124487 Nonsense 247 487 7 10
Genomic Location (Zv9):
Chromosome 5 (position 32241347)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30002177
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTARTGANTGTTTTTMCCTGTTCTCNTGATTAAAGTCAACCATTATAAATG[T/A]CCACTATGCGAAAKGACCTGTCCATCGCCGTCCTCRTTGAGAAACCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33629
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051414 Nonsense 354 487 8 9
ENSDART00000124487 Nonsense 354 487 9 10
Genomic Location (Zv9):
Chromosome 5 (position 32242951)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30003781
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATGTTTGTGAGCAGTGTTTCACCCGAGGGAATAACCTCACAGCCCACT[T/A]ACGCAAGAGACATCAGTTCAAATGGCCTTCAGGACATCCCAGGTTCAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link