rassf1

Ensembl ID:
ENSDARG00000004840
ZFIN ID:
ZDB-GENE-040912-14
Description:
ras association domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001004550]
Human Orthologue:
RASSF1
Human Description:
Ras association (RalGDS/AF-6) domain family member 1 [Source:HGNC Symbol;Acc:9882]
Mouse Orthologue:
Rassf1
Mouse Description:
Ras association (RalGDS/AF-6) domain family member 1 Gene [Source:MGI Symbol;Acc:MGI:1928386]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9614 Essential Splice Site Available for shipment Available now
sa9633 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9614
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038465 Essential Splice Site 98 363 None 6
ENSDART00000081236 None None 273 None 5
ENSDART00000126119 Essential Splice Site 98 345 None 7
ENSDART00000142265 Essential Splice Site 98 363 None 7
ENSDART00000145459 None None 303 None 5
ENSDART00000038465 Essential Splice Site 98 363 None 6
ENSDART00000081236 None None 273 None 5
ENSDART00000126119 Essential Splice Site 98 345 None 7
ENSDART00000142265 Essential Splice Site 98 363 None 7
ENSDART00000145459 None None 303 None 5
Genomic Location:
Chromosome 22 (position 10757415)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGGAGAGTTCAWCTGGGGCCTGTACAGACAGAGCCTCCGCTGCACACG[T/G]GAGTCMCCCATYCTTCAGAGACCTTCCTAGATGAGAASGGTATAAACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9633
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038465 Essential Splice Site 98 363 None 6
ENSDART00000081236 None None 273 None 5
ENSDART00000126119 Essential Splice Site 98 345 None 7
ENSDART00000142265 Essential Splice Site 98 363 None 7
ENSDART00000145459 None None 303 None 5
ENSDART00000038465 Essential Splice Site 98 363 None 6
ENSDART00000081236 None None 273 None 5
ENSDART00000126119 Essential Splice Site 98 345 None 7
ENSDART00000142265 Essential Splice Site 98 363 None 7
ENSDART00000145459 None None 303 None 5
Genomic Location:
Chromosome 22 (position 10757415)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGGAGAGTTCAWCTGGGGCCTGTACAGACAGAGCCTCCGCTGCACACG[T/G]GAGTCMCCCATYCTTCAGAGACCTTCCTAGATGAGAASGGTATAAACAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5hx57388