asz1

Ensembl ID:
ENSDARG00000004823
ZFIN ID:
ZDB-GENE-040426-988
Description:
ankyrin repeat, SAM and basic leucine zipper domain-containing protein 1 [Source:RefSeq peptide;Acc
Human Orthologue:
ASZ1
Human Description:
ankyrin repeat, SAM and basic leucine zipper domain containing 1 [Source:HGNC Symbol;Acc:1350]
Mouse Orthologue:
Asz1
Mouse Description:
ankyrin repeat, SAM and basic leucine zipper domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:192

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6515 Nonsense Mutation detected in F1 DNA During 2016
sa36638 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6515
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005145 Nonsense 7 480 1 13
Genomic Location (Zv9):
Chromosome 18 (position 20454731)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20684954
KASP Assay ID:
554-5460.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGGACCTCCTGATAWTTAACAATAATTATGATTAATGATATGTGCTA[T/A]GCTTTTCCTGCTGGCGATGAAAGCGACGGGAGTAGTGACGAATGGGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36638
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005145 Essential Splice Site 70 480 3 13
Genomic Location (Zv9):
Chromosome 18 (position 20454355)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20684578
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACACAAGTAACACAATTTACAAAGTATTCCGCTCATTATTTTTTCTCA[G/A]GTCTGGACGTGGAGACCCGACTTGGCTTTGGCTGGACACCTCTCATGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link