NP_001138254.1

Ensembl ID:
ENSDARG00000004796
Description:
probable E3 ubiquitin-protein ligase MGRN1 [Source:RefSeq peptide;Acc:NP_001138254]
Human Orthologue:
MGRN1
Human Description:
mahogunin, ring finger 1 [Source:HGNC Symbol;Acc:20254]
Mouse Orthologue:
Mgrn1
Mouse Description:
mahogunin, ring finger 1 Gene [Source:MGI Symbol;Acc:MGI:2447670]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20151 Nonsense Available for shipment Available now
sa26156 Essential Splice Site Available for shipment Available now
sa25264 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31361 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20151
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008988   None 441 None 15
ENSDART00000078221 Nonsense 72 549 3 16
Genomic Location (Zv9):
Chromosome 3 (position 55704143)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54597869
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATTAAAATGTGAGTAATATATATTTTTTTATTTCTGGCAGTTTCCCTA[T/A]GTTACTCCAGCTCCGCATGAACCAGTCAAGACATTGAGAAGTCTTGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26156
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008988 Essential Splice Site 15 441 None 15
ENSDART00000078221 Essential Splice Site 99 549 None 16
Genomic Location (Zv9):
Chromosome 3 (position 55704225)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54597951
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTGAGAAGTCTTGTCAACATTAGAAAGGACTCATTACGATTGGTCAGG[T/G]ACTGTATGAACATCATATCGCTGGTAGTCTGAGTGAAAATAATCTCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25264
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008988 Essential Splice Site 179 441 7 15
ENSDART00000078221 Essential Splice Site 263 549 9 16
ENSDART00000008988 Essential Splice Site 179 441 7 15
ENSDART00000078221 Essential Splice Site 263 549 9 16
Genomic Location (Zv9):
Chromosome 3 (position 55707018)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54600744
KASP Assay ID:
554-7838.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTACAGGAGATTTATGGAATTGAGAACAAAAATAATCAGGAAACAAAGG[T/C]GAAAAGAGGATTGTTGTTCATTTTCATTATGTTATTCATCAATTAGCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31361
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008988 Essential Splice Site 179 441 7 15
ENSDART00000078221 Essential Splice Site 263 549 9 16
ENSDART00000008988 Essential Splice Site 179 441 7 15
ENSDART00000078221 Essential Splice Site 263 549 9 16
Genomic Location (Zv9):
Chromosome 3 (position 55707018)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54600744
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTACAGGAGATTTATGGAATTGAGAACAAAAATAATCAGGAAACAAAGG[T/C]GAAAAGAGGATTGTTGTTCATTTTCATTATGTTATTCATCAATTAGCCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link