ccdc146

Ensembl ID:
ENSDARG00000004794
ZFIN ID:
ZDB-GENE-041210-217
Description:
coiled-coil domain-containing protein 146 [Source:RefSeq peptide;Acc:NP_001076522]
Human Orthologue:
CCDC146
Human Description:
coiled-coil domain containing 146 [Source:HGNC Symbol;Acc:29296]
Mouse Orthologue:
Ccdc146
Mouse Description:
coiled-coil domain containing 146 Gene [Source:MGI Symbol;Acc:MGI:1922422]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14673 Essential Splice Site Available for shipment Available now
sa15556 Essential Splice Site Available for shipment Available now
sa11874 Nonsense Available for shipment Available now
sa20266 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14673
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017947 Essential Splice Site 474 860 10 16
ENSDART00000121843 Essential Splice Site 512 953 10 17
ENSDART00000135451 None None 410 None 9
Genomic Location:
Chromosome 4 (position 19126398)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACTGGTTATACAGGAACACATTAAWCAGACTAAAGAGACACAGACAAG[G/A]TACTACCAGATTGACTGAAACAGAGCTGATGCTAAAGCAARATAKAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15556
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017947 Essential Splice Site 549 860 11 16
ENSDART00000121843 Essential Splice Site 642 953 12 17
ENSDART00000135451 None None 410 None 9
Genomic Location:
Chromosome 4 (position 19127707)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACATATCTGCAAGCGCTATGAGGCCGAACTGCAAAAGCGGAATCAAGA[G/T]TGAGACATAGAGTCTGGGGGATACAAATCTGGCAGGTGAATTCTCACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11874
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017947 Nonsense 595 860 12 16
ENSDART00000121843 Nonsense 688 953 13 17
ENSDART00000135451 None None 410 None 9
Genomic Location:
Chromosome 4 (position 19127930)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTGGAGATGTATGACATGGAAGATGAAATCAGAAACTTGAAAATGGAA[C/T]AGAAAGAAGAAGAAAGACAGAATGATCTGCACAAAAAGCAGTTGTCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20266
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017947 Essential Splice Site 625 860 12 16
ENSDART00000121843 Essential Splice Site 718 953 13 17
ENSDART00000135451 None None 410 None 9
Genomic Location:
Chromosome 4 (position 19128023)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCAAACAAACTAGCTCTGGAGGAAGAGCGTGTCTTATTACAGATACAG[G/A]TACCTGGATCACAATTTTGAAACCACTGTGAAACATTTATCTGTTAAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Response to amphetamines: Genome-wide association study of d-amphetamine response in healthy volunteers identifies putative associations, including cadherin 13 (CDH13). (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rtpnuk0o