ccdc146

Ensembl ID:: ENSDARG00000004794
ZFIN ID:: ZDB-GENE-041210-217
Description:: coiled-coil domain-containing protein 146 [Source:RefSeq peptide;Acc:NP_001076522]
Human Orthologue:: CCDC146
Human Description:: coiled-coil domain containing 146 [Source:HGNC Symbol;Acc:29296]
Mouse Orthologue:: Ccdc146
Mouse Description:: coiled-coil domain containing 146 Gene [Source:MGI Symbol;Acc:MGI:1922422]

Alleles

There are 4 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa14673	Essential Splice Site	Available for shipment	Available now
sa15556	Essential Splice Site	Available for shipment	Available now
sa11874	Nonsense	Available for shipment	Available now
sa20266	Essential Splice Site	Mutation detected in F1 DNA	During 2015

Mutation Details

Allele Name:: sa14673
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: G > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000017947	Essential Splice Site	474	860	10	16
ENSDART00000121843	Essential Splice Site	512	953	10	17
ENSDART00000135451		None	410	None	9

Genomic Location:: Chromosome 4 (position 19126398)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: GGACTGGTTATACAGGAACACATTAAWCAGACTAAAGAGACACAGACAAG[G/A]TACTACCAGATTGACTGAAACAGAGCTGATGCTAAAGCAARATAKAATTT
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa15556
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: G > T
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000017947	Essential Splice Site	549	860	11	16
ENSDART00000121843	Essential Splice Site	642	953	12	17
ENSDART00000135451		None	410	None	9

Genomic Location:: Chromosome 4 (position 19127707)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: CTACATATCTGCAAGCGCTATGAGGCCGAACTGCAAAAGCGGAATCAAGA[G/T]TGAGACATAGAGTCTGGGGGATACAAATCTGGCAGGTGAATTCTCACAGT
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa11874
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000017947	Nonsense	595	860	12	16
ENSDART00000121843	Nonsense	688	953	13	17
ENSDART00000135451		None	410	None	9

Genomic Location:: Chromosome 4 (position 19127930)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: ACTTGGAGATGTATGACATGGAAGATGAAATCAGAAACTTGAAAATGGAA[C/T]AGAAAGAAGAAGAAAGACAGAATGATCTGCACAAAAAGCAGTTGTCAAAC
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa20266
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: G > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000017947	Essential Splice Site	625	860	12	16
ENSDART00000121843	Essential Splice Site	718	953	13	17
ENSDART00000135451		None	410	None	9

Genomic Location:: Chromosome 4 (position 19128023)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: None
Flanking Sequence:: TGTCAAACAAACTAGCTCTGGAGGAAGAGCGTGTCTTATTACAGATACAG[G/A]TACCTGGATCACAATTTTGAAACCACTGTGAAACATTTATCTGTTAAAAA
Associated Phenotype:: Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Response to amphetamines: Genome-wide association study of d-amphetamine response in healthy volunteers identifies putative associations, including cadherin 13 (CDH13). (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: