
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ccdc146
- Ensembl ID:
- ENSDARG00000004794
- ZFIN ID:
- ZDB-GENE-041210-217
- Description:
- coiled-coil domain-containing protein 146 [Source:RefSeq peptide;Acc:NP_001076522]
- Human Orthologue:
- CCDC146
- Human Description:
- coiled-coil domain containing 146 [Source:HGNC Symbol;Acc:29296]
- Mouse Orthologue:
- Ccdc146
- Mouse Description:
- coiled-coil domain containing 146 Gene [Source:MGI Symbol;Acc:MGI:1922422]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa33456 | Splice Site, Nonsense | Mutation detected in F1 DNA | During 2018 |
sa14673 | Essential Splice Site | Available for shipment | Available now |
sa15556 | Essential Splice Site | Available for shipment | Available now |
sa11874 | Nonsense | Available for shipment | Available now |
sa20266 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa33456
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Splice Site, Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017947 | Splice Site, Nonsense | 153 | 860 | 4 | 16 |
ENSDART00000121843 | Splice Site, Nonsense | 153 | 953 | 3 | 17 |
ENSDART00000135451 | Splice Site, Nonsense | 153 | 410 | 4 | 9 |
- Genomic Location (Zv9):
- Chromosome 4 (position 19122063)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 20465398 GRCz11 4 20186373 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCGAATGCAAGGATGTTTTTTTTTTACAGAATTTCATTTCTGCTTTTTAG[T/A]CTTAAAGAGGAAAAGCTCTATCTTGAGAAAGAATACCAGGATCAACCTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14673
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017947 | Essential Splice Site | 474 | 860 | 10 | 16 |
ENSDART00000121843 | Essential Splice Site | 512 | 953 | 10 | 17 |
ENSDART00000135451 | None | 410 | None | 9 |
- Genomic Location (Zv9):
- Chromosome 4 (position 19126398)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 20469733 GRCz11 4 20190708 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGACTGGTTATACAGGAACACATTAAWCAGACTAAAGAGACACAGACAAG[G/A]TACTACCAGATTGACTGAAACAGAGCTGATGCTAAAGCAARATAKAATTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15556
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017947 | Essential Splice Site | 549 | 860 | 11 | 16 |
ENSDART00000121843 | Essential Splice Site | 642 | 953 | 12 | 17 |
ENSDART00000135451 | None | 410 | None | 9 |
- Genomic Location (Zv9):
- Chromosome 4 (position 19127707)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 20471042 GRCz11 4 20192017 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTACATATCTGCAAGCGCTATGAGGCCGAACTGCAAAAGCGGAATCAAGA[G/T]TGAGACATAGAGTCTGGGGGATACAAATCTGGCAGGTGAATTCTCACAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11874
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017947 | Nonsense | 595 | 860 | 12 | 16 |
ENSDART00000121843 | Nonsense | 688 | 953 | 13 | 17 |
ENSDART00000135451 | None | 410 | None | 9 |
- Genomic Location (Zv9):
- Chromosome 4 (position 19127930)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 20471265 GRCz11 4 20192240 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACTTGGAGATGTATGACATGGAAGATGAAATCAGAAACTTGAAAATGGAA[C/T]AGAAAGAAGAAGAAAGACAGAATGATCTGCACAAAAAGCAGTTGTCAAAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20266
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017947 | Essential Splice Site | 625 | 860 | 12 | 16 |
ENSDART00000121843 | Essential Splice Site | 718 | 953 | 13 | 17 |
ENSDART00000135451 | None | 410 | None | 9 |
- Genomic Location (Zv9):
- Chromosome 4 (position 19128023)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 20471358 GRCz11 4 20192333 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTCAAACAAACTAGCTCTGGAGGAAGAGCGTGTCTTATTACAGATACAG[G/A]TACCTGGATCACAATTTTGAAACCACTGTGAAACATTTATCTGTTAAAAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Response to amphetamines: Genome-wide association study of d-amphetamine response in healthy volunteers identifies putative associations, including cadherin 13 (CDH13). (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: