cops2

Ensembl ID:
ENSDARG00000004785
ZFIN ID:
ZDB-GENE-040625-15
Description:
COP9 signalosome complex subunit 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6IQT4]
Human Orthologue:
COPS2
Human Description:
COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) [Source:HGNC Symbol;Acc:30747]
Mouse Orthologue:
Cops2
Mouse Description:
COP9 (constitutive photomorphogenic) homolog, subunit 2 (Arabidopsis thaliana) Gene [Source:MGI Symb

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12873 Essential Splice Site, Missense Available for shipment Available now
sa16281 Nonsense Available for shipment Available now
sa4302 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12873
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006124 Essential Splice Site 124 443 None 13
ENSDART00000133872 Missense 125 282 4 8
Genomic Location:
Chromosome 25 (position 33356491)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGAAATCCATYAACTCCATTTTAGACTATATCTCAACCTCCAAACAGG[T/C]AATGGTATGTTTTACATTGCTGTGTGAGTTTGCATTKYATTCAGTTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16281
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006124 Nonsense 273 443 8 13
ENSDART00000133872 Nonsense 275 282 8 8
Genomic Location:
Chromosome 25 (position 33351129)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGACTTTTTTGAAGCGTTCAAAAACTAYGATGAGTCYGGAARCCCCAGA[C/T]GAACCACTTGTCTGAAGTACCTGGTCCTGGCCAACATGYTRATGAAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4302
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006124 Nonsense 420 443 13 13
ENSDART00000133872 None None 282 None 8
Genomic Location:
Chromosome 25 (position 33345391)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAAGTCAATCAGCTGTTGGAGCTCGATCACCAGAAAAGAGGCGGAGCC[C/T]GATACACGGCTCWGGACAAATGGACCAATCAGCTGAACTCTCTCAATCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x517v1oj