fgfr3

Ensembl ID:
ENSDARG00000004782
ZFIN IDs:
ZDB-GENE-000816-1, ZDB-GENE-000816-1
Description:
Fibroblast growth factor receptor 3 [Source:UniProtKB/TrEMBL;Acc:B8JIA2]
Human Orthologue:
FGFR3
Human Description:
fibroblast growth factor receptor 3 [Source:HGNC Symbol;Acc:3690]
Mouse Orthologue:
Fgfr3
Mouse Description:
fibroblast growth factor receptor 3 Gene [Source:MGI Symbol;Acc:MGI:95524]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13480 Nonsense Available for shipment Available now
sa273 Nonsense F2 line generated During 2014
sa9259 Nonsense Mutation detected in F1 DNA During 2014
sa15832 Nonsense Available for shipment Available now
sa1675 Essential Splice Site Available for shipment Available now
sa10458 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13480
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013534 Nonsense 120 804 3 23
ENSDART00000125883 Nonsense 120 802 3 22
Genomic Location:
Chromosome 13 (position 13119347)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTGTGCTGCAGACTAAAAGCATCTCTCTCTTTCTTCATTTCTCAGATT[C/A]GCTGTCCTCTGGTGATGATGAGGACTATGATGAAGATGAGGACGAGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa273
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013534 Nonsense 461 804 15 23
ENSDART00000125883 Nonsense 459 802 14 22
ENSDART00000013534 Nonsense 461 804 15 23
ENSDART00000125883 Nonsense 459 802 14 22
Genomic Location:
Chromosome 13 (position 13099390)
KASP Assay ID:
554-2825.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAAYGTGTCTGAACTTGAACTGCCCTCTGACCCCAAGTGGGAGTTTACT[C/T]GAACAAAGTGAGTTGAAGCTAAAGCACTCATCAGATGATTTTAATGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9259
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013534 Nonsense 461 804 15 23
ENSDART00000125883 Nonsense 459 802 14 22
ENSDART00000013534 Nonsense 461 804 15 23
ENSDART00000125883 Nonsense 459 802 14 22
Genomic Location:
Chromosome 13 (position 13099390)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAAYGTGTCTGAACTTGAACTGCCCTCTGACCCCAAGTGGGAGTTTACT[C/T]GAACAAAGTGAGTTGAARCTAAAGCACTYATCAGATGATTTTAATGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15832
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013534 Nonsense 560 804 18 23
ENSDART00000125883 Nonsense 558 802 17 22
Genomic Location:
Chromosome 13 (position 13097699)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTACGTGCTGGTAGAATACGCCTCTAAAGGGAATCTTAGGGAATACTTA[C/T]GAGCCAGAAGGCCACCTGGGATGGACTACTCATTCGACACCTGTAAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1675
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013534 Essential Splice Site 645 804 19 23
ENSDART00000125883 Essential Splice Site 643 802 18 22
Genomic Location:
Chromosome 13 (position 13097282)
KASP Assay ID:
554-1621.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTGCCAGAGATGTGCACAACATTGACTACTACAAGAAGACCACCAACG[T/A]AAGTCGACACWGATTATCAATCTCGAAGGAGAGAGCTCTTGGGTGGCATT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa10458
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013534 Essential Splice Site 750 804 22 23
ENSDART00000125883 Essential Splice Site 748 802 21 22
Genomic Location:
Chromosome 13 (position 13088122)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAGCTGGTGGAGGACCACGACAGGGTTCTTTCCATGACCTCCACTGAC[G/T]TAAGAGCTCTGGTGCATCAAACCAAAMACCTTAAACCTTTCACACTCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/aezdo5sk