ENSDARG00000004782 - Zebrafish Mutation Project

Search Zebrafish Mutation Project

e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457

You can look for mutant lines by browsing a complete list or by searching for a particular gene

fgfr3

Ensembl ID:: ENSDARG00000004782
ZFIN IDs:: ZDB-GENE-000816-1, ZDB-GENE-000816-1
Description:: Fibroblast growth factor receptor 3 [Source:UniProtKB/TrEMBL;Acc:B8JIA2]
Human Orthologue:: FGFR3
Human Description:: fibroblast growth factor receptor 3 [Source:HGNC Symbol;Acc:3690]
Mouse Orthologue:: Fgfr3
Mouse Description:: fibroblast growth factor receptor 3 Gene [Source:MGI Symbol;Acc:MGI:95524]

Alleles

There are 8 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa13480	Nonsense	Available for shipment	Available now
sa273	Nonsense	F2 line generated	During 2018
sa9259	Nonsense	Mutation detected in F1 DNA	During 2018
sa15832	Nonsense	Available for shipment	Available now
sa1675	Essential Splice Site	Available for shipment	Available now
sa35442	Nonsense	Mutation detected in F1 DNA	During 2018
sa28078	Essential Splice Site	Mutation detected in F1 DNA	During 2018
sa10458	Essential Splice Site	Available for shipment	Available now

Mutation Details

Allele Name:: sa13480
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: C > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000013534	Nonsense	120	804	3	23
ENSDART00000125883	Nonsense	120	802	3	22

Genomic Location (Zv9):

Chromosome 13 (position 13119347)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	13	13127432
GRCz11	13	13258565

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

CACTGTGCTGCAGACTAAAAGCATCTCTCTCTTTCTTCATTTCTCAGATT[C/A]GCTGTCCTCTGGTGATGATGAGGACTATGATGAAGATGAGGACGAGGCAG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa273
Current Status:: F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000013534	Nonsense	461	804	15	23
ENSDART00000125883	Nonsense	459	802	14	22
ENSDART00000013534	Nonsense	461	804	15	23
ENSDART00000125883	Nonsense	459	802	14	22

Genomic Location (Zv9):

Chromosome 13 (position 13099390)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	13	13097758
GRCz11	13	13230233

KASP Assay ID:

554-2825.1 (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

CTAAYGTGTCTGAACTTGAACTGCCCTCTGACCCCAAGTGGGAGTTTACT[C/T]GAACAAAGTGAGTTGAAGCTAAAGCACTCATCAGATGATTTTAATGAAGC

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa9259
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000013534	Nonsense	461	804	15	23
ENSDART00000125883	Nonsense	459	802	14	22
ENSDART00000013534	Nonsense	461	804	15	23
ENSDART00000125883	Nonsense	459	802	14	22

Genomic Location (Zv9):

Chromosome 13 (position 13099390)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	13	13097758
GRCz11	13	13230233

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

CTAAYGTGTCTGAACTTGAACTGCCCTCTGACCCCAAGTGGGAGTTTACT[C/T]GAACAAAGTGAGTTGAARCTAAAGCACTYATCAGATGATTTTAATGAAGC

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa15832
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000013534	Nonsense	560	804	18	23
ENSDART00000125883	Nonsense	558	802	17	22

Genomic Location (Zv9):

Chromosome 13 (position 13097699)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	13	13096067
GRCz11	13	13228542

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

TGTACGTGCTGGTAGAATACGCCTCTAAAGGGAATCTTAGGGAATACTTA[C/T]GAGCCAGAAGGCCACCTGGGATGGACTACTCATTCGACACCTGTAAGATC

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa1675
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: T > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000013534	Essential Splice Site	645	804	19	23
ENSDART00000125883	Essential Splice Site	643	802	18	22

Genomic Location (Zv9):

Chromosome 13 (position 13097282)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	13	13095650
GRCz11	13	13228125

KASP Assay ID:

554-1621.1 (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

CCTTGCCAGAGATGTGCACAACATTGACTACTACAAGAAGACCACCAACG[T/A]AAGTCGACACWGATTATCAATCTCGAAGGAGAGAGCTCTTGGGTGGCATT

Associated Phenotype:

Normal

Stage	Entity	Quality	Tag
Larval:Day 5 ZFS:0000037	whole organism ZFA:0001094	quality PATO:0000001	normal PATO:0000461

Mutation Details

Allele Name:: sa35442
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000013534	Nonsense	687	804	21	23
ENSDART00000125883	Nonsense	685	802	20	22

Genomic Location (Zv9):

Chromosome 13 (position 13090690)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	13	13089058
GRCz11	13	13221533

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

TCTTATGGTGTGTTGTTGTGGGAGATTTTCACTCTTGGTGGATCCCCGTA[T/A]CCAGGTATCCCAGTGGAGGAGCTCTTTAAACTGCTGAAGGAAGGCCATCG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa28078
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: T > C
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000013534	Essential Splice Site	715	804	21	23
ENSDART00000125883	Essential Splice Site	713	802	20	22

Genomic Location (Zv9):

Chromosome 13 (position 13090605)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	13	13088973
GRCz11	13	13221448

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

TGAAGGAAGGCCATCGGATGGACAAACCGGCCAACTGCACTCATGAACTG[T/C]ACGCTTGTTATTCATCTTTTAAAACGCCTCATGTTTTGAGTCATCTCATG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa10458
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: G > T
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000013534	Essential Splice Site	750	804	22	23
ENSDART00000125883	Essential Splice Site	748	802	21	22

Genomic Location (Zv9):

Chromosome 13 (position 13088122)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	13	13086490
GRCz11	13	13218965

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

GACAGCTGGTGGAGGACCACGACAGGGTTCTTTCCATGACCTCCACTGAC[G/T]TAAGAGCTCTGGTGCATCAAACCAAAMACCTTAAACCTTTCACACTCAAC

Associated Phenotype:

Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Bladder cancer: A multi-stage genome-wide association study of bladder cancer identifies multiple susceptibility loci. (View Study)
Urinary bladder cancer: A sequence variant at 4p16.3 confers susceptibility to urinary bladder cancer. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

More OMIM information for FGFR3

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: