Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
fgfr3
- Ensembl ID:
- ENSDARG00000004782
- ZFIN IDs:
- ZDB-GENE-000816-1, ZDB-GENE-000816-1
- Description:
- Fibroblast growth factor receptor 3 [Source:UniProtKB/TrEMBL;Acc:B8JIA2]
- Human Orthologue:
- FGFR3
- Human Description:
- fibroblast growth factor receptor 3 [Source:HGNC Symbol;Acc:3690]
- Mouse Orthologue:
- Fgfr3
- Mouse Description:
- fibroblast growth factor receptor 3 Gene [Source:MGI Symbol;Acc:MGI:95524]
Alleles
There are 8 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa13480 | Nonsense | Available for shipment | Available now |
| sa273 | Nonsense | F2 line generated | During 2017 |
| sa9259 | Nonsense | Mutation detected in F1 DNA | During 2017 |
| sa15832 | Nonsense | Available for shipment | Available now |
| sa1675 | Essential Splice Site | Available for shipment | Available now |
| sa35442 | Nonsense | Mutation detected in F1 DNA | During 2017 |
| sa28078 | Essential Splice Site | Mutation detected in F1 DNA | During 2017 |
| sa10458 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa13480
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000013534 | Nonsense | 120 | 804 | 3 | 23 |
| ENSDART00000125883 | Nonsense | 120 | 802 | 3 | 22 |
- Genomic Location (Zv9):
- Chromosome 13 (position 13119347)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 13127432 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CACTGTGCTGCAGACTAAAAGCATCTCTCTCTTTCTTCATTTCTCAGATT[C/A]GCTGTCCTCTGGTGATGATGAGGACTATGATGAAGATGAGGACGAGGCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa273
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2017.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000013534 | Nonsense | 461 | 804 | 15 | 23 |
| ENSDART00000125883 | Nonsense | 459 | 802 | 14 | 22 |
| ENSDART00000013534 | Nonsense | 461 | 804 | 15 | 23 |
| ENSDART00000125883 | Nonsense | 459 | 802 | 14 | 22 |
- Genomic Location (Zv9):
- Chromosome 13 (position 13099390)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 13097758 - KASP Assay ID:
- 554-2825.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTAAYGTGTCTGAACTTGAACTGCCCTCTGACCCCAAGTGGGAGTTTACT[C/T]GAACAAAGTGAGTTGAAGCTAAAGCACTCATCAGATGATTTTAATGAAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9259
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2017.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000013534 | Nonsense | 461 | 804 | 15 | 23 |
| ENSDART00000125883 | Nonsense | 459 | 802 | 14 | 22 |
| ENSDART00000013534 | Nonsense | 461 | 804 | 15 | 23 |
| ENSDART00000125883 | Nonsense | 459 | 802 | 14 | 22 |
- Genomic Location (Zv9):
- Chromosome 13 (position 13099390)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 13097758 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTAAYGTGTCTGAACTTGAACTGCCCTCTGACCCCAAGTGGGAGTTTACT[C/T]GAACAAAGTGAGTTGAARCTAAAGCACTYATCAGATGATTTTAATGAAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15832
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000013534 | Nonsense | 560 | 804 | 18 | 23 |
| ENSDART00000125883 | Nonsense | 558 | 802 | 17 | 22 |
- Genomic Location (Zv9):
- Chromosome 13 (position 13097699)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 13096067 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTACGTGCTGGTAGAATACGCCTCTAAAGGGAATCTTAGGGAATACTTA[C/T]GAGCCAGAAGGCCACCTGGGATGGACTACTCATTCGACACCTGTAAGATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1675
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000013534 | Essential Splice Site | 645 | 804 | 19 | 23 |
| ENSDART00000125883 | Essential Splice Site | 643 | 802 | 18 | 22 |
- Genomic Location (Zv9):
- Chromosome 13 (position 13097282)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 13095650 - KASP Assay ID:
- 554-1621.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCTTGCCAGAGATGTGCACAACATTGACTACTACAAGAAGACCACCAACG[T/A]AAGTCGACACWGATTATCAATCTCGAAGGAGAGAGCTCTTGGGTGGCATT
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa35442
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2017.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000013534 | Nonsense | 687 | 804 | 21 | 23 |
| ENSDART00000125883 | Nonsense | 685 | 802 | 20 | 22 |
- Genomic Location (Zv9):
- Chromosome 13 (position 13090690)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 13089058 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTTATGGTGTGTTGTTGTGGGAGATTTTCACTCTTGGTGGATCCCCGTA[T/A]CCAGGTATCCCAGTGGAGGAGCTCTTTAAACTGCTGAAGGAAGGCCATCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa28078
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2017.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000013534 | Essential Splice Site | 715 | 804 | 21 | 23 |
| ENSDART00000125883 | Essential Splice Site | 713 | 802 | 20 | 22 |
- Genomic Location (Zv9):
- Chromosome 13 (position 13090605)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 13088973 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAAGGAAGGCCATCGGATGGACAAACCGGCCAACTGCACTCATGAACTG[T/C]ACGCTTGTTATTCATCTTTTAAAACGCCTCATGTTTTGAGTCATCTCATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10458
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000013534 | Essential Splice Site | 750 | 804 | 22 | 23 |
| ENSDART00000125883 | Essential Splice Site | 748 | 802 | 21 | 22 |
- Genomic Location (Zv9):
- Chromosome 13 (position 13088122)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 13086490 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GACAGCTGGTGGAGGACCACGACAGGGTTCTTTCCATGACCTCCACTGAC[G/T]TAAGAGCTCTGGTGCATCAAACCAAAMACCTTAAACCTTTCACACTCAAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Bladder cancer: A multi-stage genome-wide association study of bladder cancer identifies multiple susceptibility loci. (View Study)
- Urinary bladder cancer: A sequence variant at 4p16.3 confers susceptibility to urinary bladder cancer. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
- Achondroplasia
- Bladder cancer, somatic
- CATSHL syndrome
- Cervical cancer, somatic
- Colorectal cancer, somatic
- Crouzon syndrome with acanthosis nigricans
- Hypochondroplasia
- LADD syndrome
- Muenke syndrome
- Nevus, epidermal, somatic
- Spermatocytic seminoma, somatic
- Thanatophoric dysplasia, type I
- Thanatophoric dysplasia, type II
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
