ybx1

Ensembl ID:
ENSDARG00000004757
ZFIN ID:
ZDB-GENE-000629-3
Description:
Y box binding protein 1 isoform 1 [Source:RefSeq peptide;Acc:NP_001119929]
Human Orthologue:
YBX1
Human Description:
Y box binding protein 1 [Source:HGNC Symbol;Acc:8014]
Mouse Orthologue:
Ybx1
Mouse Description:
Y box protein 1 Gene [Source:MGI Symbol;Acc:MGI:99146]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21382 Nonsense Mutation detected in F1 DNA During 2014
sa21381 Essential Splice Site Mutation detected in F1 DNA During 2014
sa42 Missense Available for shipment Available now

Mutation Details

Allele Name:
sa21382
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024320 Nonsense 12 309 1 8
ENSDART00000110512 Nonsense 12 237 1 6

The following transcripts of ENSDARG00000004757 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 49307986)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAACAAGAAAACAACATGAGCAGCGAGGCCGAGACACAACAGCCGCCG[C/T]AGCCTGCCGCCGACGCGGAGAGCCCGTCCAGCCCGGCAGCCGCAGCTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21381
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024320 Essential Splice Site 68 309 None 8
ENSDART00000110512 None None 237 None 6

The following transcripts of ENSDARG00000004757 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 49305528)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTATTTTTGCAGGAATGACACAAAGGAAGATGTCTTTGTGCATCAGG[T/C]GATTATTTTCTCCAGTTTTCTTTTTATATTTGTGTTGGGGTAGATGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024320 Missense 83 309 4 8
ENSDART00000110512 None None 237 None 6

The following transcripts of ENSDARG00000004757 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 49305405)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTCTAGACCGCCATTAAAAAGAACAACCCCAGGAAATATCTCCGTAGC[G/T]TTGGGGACGGAGAGACTGTGGAGTTCGACGTGGTAGAAGGGGAGAAGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p35sqpml