ybx1

Ensembl ID:
ENSDARG00000004757
ZFIN ID:
ZDB-GENE-000629-3
Description:
Y box binding protein 1 isoform 1 [Source:RefSeq peptide;Acc:NP_001119929]
Human Orthologue:
YBX1
Human Description:
Y box binding protein 1 [Source:HGNC Symbol;Acc:8014]
Mouse Orthologue:
Ybx1
Mouse Description:
Y box protein 1 Gene [Source:MGI Symbol;Acc:MGI:99146]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34489 Nonsense Mutation detected in F1 DNA During 2016
sa21382 Nonsense Available for shipment Available now
sa21381 Essential Splice Site Available for shipment Available now
sa42 Missense Available for shipment Available now

Mutation Details

Allele Name:
sa34489
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024320 Nonsense 9 309 1 8
ENSDART00000110512 Nonsense 9 237 1 6

The following transcripts of ENSDARG00000004757 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 49307995)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 47161390
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGGCTTTACCAACAAGAAAACAACATGAGCAGCGAGGCCGAGACACAA[C/T]AGCCGCCGCAGCCTGCCGCCGACGCGGAGAGCCCGTCCAGCCCGGCAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21382
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024320 Nonsense 12 309 1 8
ENSDART00000110512 Nonsense 12 237 1 6

The following transcripts of ENSDARG00000004757 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 49307986)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 47161381
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAACAAGAAAACAACATGAGCAGCGAGGCCGAGACACAACAGCCGCCG[C/T]AGCCTGCCGCCGACGCGGAGAGCCCGTCCAGCCCGGCAGCCGCAGCTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21381
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024320 Essential Splice Site 68 309 None 8
ENSDART00000110512   None 237 None 6

The following transcripts of ENSDARG00000004757 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 49305528)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 47158923
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTATTTTTGCAGGAATGACACAAAGGAAGATGTCTTTGTGCATCAGG[T/C]GATTATTTTCTCCAGTTTTCTTTTTATATTTGTGTTGGGGTAGATGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024320 Missense 83 309 4 8
ENSDART00000110512   None 237 None 6

The following transcripts of ENSDARG00000004757 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 49305405)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 47158800
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTCTAGACCGCCATTAAAAAGAACAACCCCAGGAAATATCTCCGTAGC[G/T]TTGGGGACGGAGAGACTGTGGAGTTCGACGTGGTAGAAGGGGAGAAGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link