MYLK (1 of 2)

Ensembl ID:
ENSDARG00000004753
Description:
myosin light chain kinase [Source:HGNC Symbol;Acc:7590]
Human Orthologue:
MYLK
Human Description:
myosin light chain kinase [Source:HGNC Symbol;Acc:7590]
Mouse Orthologue:
Mylk
Mouse Description:
myosin, light polypeptide kinase Gene [Source:MGI Symbol;Acc:MGI:894806]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20669 Nonsense Mutation detected in F1 DNA During 2014
sa20668 Essential Splice Site Mutation detected in F1 DNA During 2014
sa1486 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20669
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027684 Nonsense 425 966 7 17
Genomic Location:
Chromosome 6 (position 13388060)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCTTGGTATGGGCCCACTTATGATGGTGGCAGCATCGTCCAGTCGTA[C/A]AACCTGGAGATCTGGAACTCGGTGGACAACACATGGAATGACCTCACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20668
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027684 Essential Splice Site 603 966 10 17
Genomic Location:
Chromosome 6 (position 13384541)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATGGACGCCTTCGAGGGAAAATCGGACATGGTCATGGTCATGGAGATG[T/C]GAGTCTCTAACCTAATCAAAAATCCGAAAGGCTAATGTGAAGCAGATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1486
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027684 Nonsense 623 966 11 17
Genomic Location:
Chromosome 6 (position 13379255)
KASP Assay ID:
554-1411.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGGMGAGCTGTTTGAGCGAATCGTGGATGAAGATTTYGAGCTGACCGAG[C/T]GAGAGGTGATTAAGTACATGCTGCAGATCATAGATGGAGTCCAGTTCATC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rurac5po