hnrnpu

Ensembl ID:
ENSDARG00000004735
ZFIN ID:
ZDB-GENE-030131-6422
Description:
heterogeneous nuclear ribonucleoprotein U isoform 2 [Source:RefSeq peptide;Acc:NP_001028767]
Human Orthologue:
HNRNPU
Human Description:
heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A) [Source:HGNC Symbol;Acc:504
Mouse Orthologue:
Hnrnpu
Mouse Description:
heterogeneous nuclear ribonucleoprotein U Gene [Source:MGI Symbol;Acc:MGI:1858195]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23760 Nonsense Mutation detected in F1 DNA During 2014
sa17952 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23760
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122696 Nonsense 28 796 1 13

The following transcripts of ENSDARG00000004735 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 35083472)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACGAGCTGAAGGACGAGCTAAAGAAGCGGCAGCTCTCTGACAAGGGGT[T/A]GAAGGCCGAGCTCATGGAGCGTCTGCAGGCCGCGCTCGACGCAGAGGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17952
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122696 Nonsense 613 796 10 13

The following transcripts of ENSDARG00000004735 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 35090116)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGAAGAAGCCCAACCAGGGACCCCCAACTCCCAAACGGGGATCCCGC[C/T]GAGGMAGAGGGCAAAAGAACCAGTTCAACAGGANNNNNNNNNGTGGTGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x2uvt420