foigr

Ensembl ID:
ENSDARG00000004726
ZFIN ID:
ZDB-GENE-030131-1723
Description:
UPF0636 protein C4orf41 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q1RLX4]
Human Orthologue:
C4orf41
Human Description:
chromosome 4 open reading frame 41 [Source:HGNC Symbol;Acc:25751]
Mouse Orthologue:
D030016E14Rik
Mouse Description:
RIKEN cDNA D030016E14 gene Gene [Source:MGI Symbol;Acc:MGI:2444585]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22424 Nonsense Mutation detected in F1 DNA During 2016
sa30977 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22424
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054809 Nonsense 693 1132 20 30
Genomic Location (Zv9):
Chromosome 14 (position 7305894)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 7031373
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGTCTGGTTTTGTCTTTCAGATCACCAGTGTGGGACTAATGTTAGGT[C/T]GAGAAACGGGCCGTTATGTTTATCTGAATTGGCGGGGCGGTTGGGGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30977
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054809 Essential Splice Site 898 1132 24 30
Genomic Location (Zv9):
Chromosome 14 (position 7303714)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 7029193
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAAACGGTTGTTCCCTTTGAAGTGGCTATGAAGTTTGTGTCCAGTAAG[G/A]TAAGAGGTTTCACTTGGGAGATTTCGGTAATGAAAATCCGTAGTCGTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link