foigr

Ensembl ID:
ENSDARG00000004726
ZFIN ID:
ZDB-GENE-030131-1723
Description:
UPF0636 protein C4orf41 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q1RLX4]
Human Orthologue:
C4orf41
Human Description:
chromosome 4 open reading frame 41 [Source:HGNC Symbol;Acc:25751]
Mouse Orthologue:
D030016E14Rik
Mouse Description:
RIKEN cDNA D030016E14 gene Gene [Source:MGI Symbol;Acc:MGI:2444585]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3887 Essential Splice Site Mutation detected in F1 DNA During 2015
sa22424 Nonsense Mutation detected in F1 DNA During 2015
sa30977 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa3887
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054809 Essential Splice Site 149 1132 4 30
Genomic Location:
Chromosome 14 (position 7335126)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAAGGTYGCTGTTGTTCTGATTCAGAAGAAAACCCCTCTCCCACCAGG[T/A]AACGCAAAACTGAAATGCTTGCTTTTAGTACTTCAGTCTAGATGTTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22424
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054809 Nonsense 693 1132 20 30
Genomic Location:
Chromosome 14 (position 7305894)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGTCTGGTTTTGTCTTTCAGATCACCAGTGTGGGACTAATGTTAGGT[C/T]GAGAAACGGGCCGTTATGTTTATCTGAATTGGCGGGGCGGTTGGGGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30977
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054809 Essential Splice Site 898 1132 24 30
Genomic Location:
Chromosome 14 (position 7303714)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAAACGGTTGTTCCCTTTGAAGTGGCTATGAAGTTTGTGTCCAGTAAG[G/A]TAAGAGGTTTCACTTGGGAGATTTCGGTAATGAAAATCCGTAGTCGTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xhafjdwg