tcea3

Ensembl ID:
ENSDARG00000004724
ZFIN ID:
ZDB-GENE-040426-1860
Description:
transcription elongation factor A protein 3 [Source:RefSeq peptide;Acc:NP_991246]
Human Orthologue:
TCEA3
Human Description:
transcription elongation factor A (SII), 3 [Source:HGNC Symbol;Acc:11615]
Mouse Orthologue:
Tcea3
Mouse Description:
transcription elongation factor A (SII), 3 Gene [Source:MGI Symbol;Acc:MGI:1196908]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4674 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22897 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4674
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006061 Essential Splice Site 80 409 4 14
ENSDART00000134037 Essential Splice Site 80 305 4 10
ENSDART00000140552 Essential Splice Site 80 201 4 6
Genomic Location:
Chromosome 16 (position 36534746)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCATAAATTTATCTTGTTTTGCCTATACCTATGSTTTTGTGTCTGTC[A/T]GAATCAGCTCAGAACCCAAAATCTGAGAGGCCAAATGAGGTGAAGAACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006061 Nonsense 163 409 6 14
ENSDART00000134037 Nonsense 135 305 5 10
ENSDART00000140552 None None 201 None 6
Genomic Location:
Chromosome 16 (position 36547150)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCACAGATTCCAAAAAGCCTCTTCCTAGGAAGCCGAGCCTGGATGGA[C/T]GAAGAGACAGGTCAGCTCAAGCATTACTCATCAACAAATCTGATGAAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3cgezpm2