tcea3

Ensembl ID:
ENSDARG00000004724
ZFIN ID:
ZDB-GENE-040426-1860
Description:
transcription elongation factor A protein 3 [Source:RefSeq peptide;Acc:NP_991246]
Human Orthologue:
TCEA3
Human Description:
transcription elongation factor A (SII), 3 [Source:HGNC Symbol;Acc:11615]
Mouse Orthologue:
Tcea3
Mouse Description:
transcription elongation factor A (SII), 3 Gene [Source:MGI Symbol;Acc:MGI:1196908]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4674 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42773 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22897 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa4674
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006061 Essential Splice Site 80 409 4 14
ENSDART00000134037 Essential Splice Site 80 305 4 10
ENSDART00000140552 Essential Splice Site 80 201 4 6
Genomic Location:
Chromosome 16 (position 36534746)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCATAAATTTATCTTGTTTTGCCTATACCTATGSTTTTGTGTCTGTC[A/T]GAATCAGCTCAGAACCCAAAATCTGAGAGGCCAAATGAGGTGAAGAACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42773
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006061 Essential Splice Site 116 409 4 14
ENSDART00000134037 Essential Splice Site 116 305 4 10
ENSDART00000140552 Essential Splice Site 116 201 4 6
Genomic Location:
Chromosome 16 (position 36534858)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAGCCATCGGGATCACCCAGCAGGACTTCTCCTGAGAAAGACTCCAGG[T/C]ACGTTTGCTGATAACAATGAGAAACACGGAAGAAGTCCCGAAATAGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006061 Nonsense 163 409 6 14
ENSDART00000134037 Nonsense 135 305 5 10
ENSDART00000140552   None 201 None 6
Genomic Location:
Chromosome 16 (position 36547150)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCACAGATTCCAAAAAGCCTCTTCCTAGGAAGCCGAGCCTGGATGGA[C/T]GAAGAGACAGGTCAGCTCAAGCATTACTCATCAACAAATCTGATGAAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link