ENSDARG00000004722

Ensembl ID:
ENSDARG00000004722
Human Orthologue:
DDR2
Human Description:
discoidin domain receptor tyrosine kinase 2 [Source:HGNC Symbol;Acc:2731]
Mouse Orthologue:
Ddr2
Mouse Description:
discoidin domain receptor family, member 2 Gene [Source:MGI Symbol;Acc:MGI:1345277]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13982 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13982
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049466 Nonsense 716 740 13 13
Genomic Location:
Chromosome 5 (position 10378118)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCCGCCGCTCTGCCCATCCTCCCTMTTMAAGYTGATGAWGCGCTGCTG[G/A]AGTCGTGACATCACAGACCGGCCATYGTTTAACAAATTGCATCAGGCCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/96hhowkr