mpp5b

Ensembl ID:
ENSDARG00000004721
ZFIN ID:
ZDB-GENE-060531-2
Description:
membrane protein, palmitoylated 5b (MAGUK p55 subfamily member 5b) [Source:RefSeq peptide;Acc:NP_00
Human Orthologue:
MPP5
Human Description:
membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) [Source:HGNC Symbol;Acc:18669]
Mouse Orthologue:
Mpp5
Mouse Description:
membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) Gene [Source:MGI Symbol;Acc:MGI:192

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3102 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3102
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028084 Nonsense 387 639 9 14
ENSDART00000144365 Nonsense 302 549 7 12
Genomic Location:
Chromosome 20 (position 51384359)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCACCGAGAAGCCATGAAGAAAACCATTACAGACAAAAATGAAGAGTA[T/G]AAAGGTGAGCCGGCCTGATATAGACTTACACCCTAYCAGATCAGAAAACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b5djye8m