tcf12

Ensembl ID:: ENSDARG00000004714
ZFIN ID:: ZDB-GENE-040516-11
Description:: transcription factor 12 [Source:RefSeq peptide;Acc:NP_999981]
Human Orthologue:: TCF12
Human Description:: transcription factor 12 [Source:HGNC Symbol;Acc:11623]
Mouse Orthologue:: Tcf12
Mouse Description:: transcription factor 12 Gene [Source:MGI Symbol;Acc:MGI:101877]

Alleles

There are 2 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa27060	Essential Splice Site	Mutation detected in F1 DNA	During 2015
sa14175	Nonsense	Available for shipment	Available now

Mutation Details

Allele Name:: sa27060
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: G > T
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000009938		None	533	None	13
ENSDART00000073766	Essential Splice Site	None	336	1	13
ENSDART00000127387		None	591	None	14
ENSDART00000131282	Essential Splice Site	None	702	1	19
ENSDART00000136745	Essential Splice Site	None	54	1	4
ENSDART00000138263		None	177	None	6

The following transcripts of ENSDARG00000004714 do not overlap with this mutation:

ENSDART00000140338

Genomic Location:: Chromosome 7 (position 54164770)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: None
Flanking Sequence:: CGTGACTGGCACACCCGATCGCCCTAGTTGGATTTTTGACAGGATAAAAG[G/T]TAAAATAATGCACAGCGAGTTTCTGAGTGGTTTCGGACTGGGTGAAAGAA
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa14175
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000009938	Nonsense	22	533	2	13
ENSDART00000073766	Nonsense	191	336	9	13
ENSDART00000127387	Nonsense	86	591	4	14
ENSDART00000131282	Nonsense	191	702	9	19
ENSDART00000136745		None	54	None	4
ENSDART00000138263	Nonsense	22	177	2	6

The following transcripts of ENSDARG00000004714 do not overlap with this mutation:

ENSDART00000140338

Genomic Location:: Chromosome 7 (position 54006676)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: GGTTCTCAGTAGTAATRCTTTTTTTTNATTTATGTGTGTCTGCAGGTGTA[T/A]GCACCATCTCCCAGCTCAGAGGACTWCAACAGAGACTCTCCGTCTTATCC
Associated Phenotype:: Not determined

OMIM

OMIM information for TCF12

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: