tcf12

Ensembl ID:
ENSDARG00000004714
ZFIN ID:
ZDB-GENE-040516-11
Description:
transcription factor 12 [Source:RefSeq peptide;Acc:NP_999981]
Human Orthologue:
TCF12
Human Description:
transcription factor 12 [Source:HGNC Symbol;Acc:11623]
Mouse Orthologue:
Tcf12
Mouse Description:
transcription factor 12 Gene [Source:MGI Symbol;Acc:MGI:101877]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14175 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14175
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009938 Nonsense 22 533 2 13
ENSDART00000073766 Nonsense 191 336 9 13
ENSDART00000127387 Nonsense 86 591 4 14
ENSDART00000131282 Nonsense 191 702 9 19
ENSDART00000136745 None None 54 None 4
ENSDART00000138263 Nonsense 22 177 2 6

The following transcripts of ENSDARG00000004714 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 54006676)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTCTCAGTAGTAATRCTTTTTTTTNATTTATGTGTGTCTGCAGGTGTA[T/A]GCACCATCTCCCAGCTCAGAGGACTWCAACAGAGACTCTCCGTCTTATCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ie0ufrwh