Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tcf12
- Ensembl ID:
- ENSDARG00000004714
- ZFIN ID:
- ZDB-GENE-040516-11
- Description:
- transcription factor 12 [Source:RefSeq peptide;Acc:NP_999981]
- Human Orthologue:
- TCF12
- Human Description:
- transcription factor 12 [Source:HGNC Symbol;Acc:11623]
- Mouse Orthologue:
- Tcf12
- Mouse Description:
- transcription factor 12 Gene [Source:MGI Symbol;Acc:MGI:101877]
Alleles
There are 3 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa27060 | Essential Splice Site | Mutation detected in F1 DNA | During 2016 |
| sa14175 | Nonsense | Available for shipment | Available now |
| sa31600 | Essential Splice Site | Mutation detected in F1 DNA | During 2016 |
Mutation Details
- Allele Name:
- sa27060
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2016.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000009938 | None | 533 | None | 13 | |
| ENSDART00000073766 | Essential Splice Site | None | 336 | 1 | 13 |
| ENSDART00000127387 | None | 591 | None | 14 | |
| ENSDART00000131282 | Essential Splice Site | None | 702 | 1 | 19 |
| ENSDART00000136745 | Essential Splice Site | None | 54 | 1 | 4 |
| ENSDART00000138263 | None | 177 | None | 6 |
The following transcripts of ENSDARG00000004714 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 54164770)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 52434620 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGTGACTGGCACACCCGATCGCCCTAGTTGGATTTTTGACAGGATAAAAG[G/T]TAAAATAATGCACAGCGAGTTTCTGAGTGGTTTCGGACTGGGTGAAAGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14175
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000009938 | Nonsense | 22 | 533 | 2 | 13 |
| ENSDART00000073766 | Nonsense | 191 | 336 | 9 | 13 |
| ENSDART00000127387 | Nonsense | 86 | 591 | 4 | 14 |
| ENSDART00000131282 | Nonsense | 191 | 702 | 9 | 19 |
| ENSDART00000136745 | None | 54 | None | 4 | |
| ENSDART00000138263 | Nonsense | 22 | 177 | 2 | 6 |
The following transcripts of ENSDARG00000004714 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 54006676)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 52276526 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGTTCTCAGTAGTAATRCTTTTTTTTNATTTATGTGTGTCTGCAGGTGTA[T/A]GCACCATCTCCCAGCTCAGAGGACTWCAACAGAGACTCTCCGTCTTATCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31600
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2016.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000009938 | Essential Splice Site | 54 | 533 | 2 | 13 |
| ENSDART00000073766 | Essential Splice Site | 223 | 336 | 9 | 13 |
| ENSDART00000127387 | Essential Splice Site | 118 | 591 | 4 | 14 |
| ENSDART00000131282 | Essential Splice Site | 223 | 702 | 9 | 19 |
| ENSDART00000136745 | None | 54 | None | 4 | |
| ENSDART00000138263 | Essential Splice Site | 54 | 177 | 2 | 6 |
The following transcripts of ENSDARG00000004714 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 54006580)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 52276430 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATCCGTCTCCAAAACCCCCCGGCAGTATGTTCGCAAGCACTTTCTTTGG[T/G]CAGTCATCAGCATTTTATTCATTTATATTTAATTCTTTGTTTGATTGTCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
