tcf12

Ensembl ID:
ENSDARG00000004714
ZFIN ID:
ZDB-GENE-040516-11
Description:
transcription factor 12 [Source:RefSeq peptide;Acc:NP_999981]
Human Orthologue:
TCF12
Human Description:
transcription factor 12 [Source:HGNC Symbol;Acc:11623]
Mouse Orthologue:
Tcf12
Mouse Description:
transcription factor 12 Gene [Source:MGI Symbol;Acc:MGI:101877]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27060 Essential Splice Site Mutation detected in F1 DNA During 2016
sa14175 Nonsense Available for shipment Available now
sa31600 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa27060
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009938   None 533 None 13
ENSDART00000073766 Essential Splice Site None 336 1 13
ENSDART00000127387   None 591 None 14
ENSDART00000131282 Essential Splice Site None 702 1 19
ENSDART00000136745 Essential Splice Site None 54 1 4
ENSDART00000138263   None 177 None 6

The following transcripts of ENSDARG00000004714 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 54164770)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52434620
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGACTGGCACACCCGATCGCCCTAGTTGGATTTTTGACAGGATAAAAG[G/T]TAAAATAATGCACAGCGAGTTTCTGAGTGGTTTCGGACTGGGTGAAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14175
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009938 Nonsense 22 533 2 13
ENSDART00000073766 Nonsense 191 336 9 13
ENSDART00000127387 Nonsense 86 591 4 14
ENSDART00000131282 Nonsense 191 702 9 19
ENSDART00000136745   None 54 None 4
ENSDART00000138263 Nonsense 22 177 2 6

The following transcripts of ENSDARG00000004714 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 54006676)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52276526
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTCTCAGTAGTAATRCTTTTTTTTNATTTATGTGTGTCTGCAGGTGTA[T/A]GCACCATCTCCCAGCTCAGAGGACTWCAACAGAGACTCTCCGTCTTATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31600
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009938 Essential Splice Site 54 533 2 13
ENSDART00000073766 Essential Splice Site 223 336 9 13
ENSDART00000127387 Essential Splice Site 118 591 4 14
ENSDART00000131282 Essential Splice Site 223 702 9 19
ENSDART00000136745   None 54 None 4
ENSDART00000138263 Essential Splice Site 54 177 2 6

The following transcripts of ENSDARG00000004714 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 54006580)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52276430
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCCGTCTCCAAAACCCCCCGGCAGTATGTTCGCAAGCACTTTCTTTGG[T/G]CAGTCATCAGCATTTTATTCATTTATATTTAATTCTTTGTTTGATTGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link