mad2l1

Ensembl ID:
ENSDARG00000004713
ZFIN ID:
ZDB-GENE-030515-3
Description:
mitotic spindle assembly checkpoint protein MAD2A [Source:RefSeq peptide;Acc:NP_001017739]
Human Orthologues:
AL132777.1, MAD2L1
Human Description:
MAD2 mitotic arrest deficient-like 1 (yeast) [Source:HGNC Symbol;Acc:6763]
Mouse Orthologue:
Mad2l1
Mouse Description:
MAD2 mitotic arrest deficient-like 1 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1860374]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41050 Nonsense Mutation detected in F1 DNA During 2017
sa41049 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41050
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028017 Nonsense 68 202 2 5
Genomic Location (Zv9):
Chromosome 7 (position 58881328)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 57333937
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGACCACAGATACCAAACTGAAGAATTACCTCACCAATGTCATCTCA[C/T]AACTCAAAGGTTGGTTTTCACCCACGTGTCCAAGGGAAGAAATATAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41049
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028017 Nonsense 181 202 5 5
Genomic Location (Zv9):
Chromosome 7 (position 58874533)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 57327142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAAGAGTCTGGGCCTCAGCTAATCGATCAGTCAGAAGAGGTGCGCCTG[C/T]GATCCTTTACTACGTCTATTCATAAGGTGAACAGTATGGTGGCCTACAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • F-cell distribution: Genome-wide association study identifies genetic variants influencing F-cell levels in sickle-cell patients. (View Study)
  • HIV-1 viral setpoint: Genomewide association study for determinants of HIV-1 acquisition and viral set point in HIV-1 serodiscordant couples with quantified virus exposure. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link