tbr1b

Ensembl ID:
ENSDARG00000004712
ZFIN IDs:
ZDB-GENE-000323-1, ZDB-GENE-000323-1
Description:
T-box brain protein 1 [Source:RefSeq peptide;Acc:NP_001108562]
Human Orthologue:
TBR1
Human Description:
T-box, brain, 1 [Source:HGNC Symbol;Acc:11590]
Mouse Orthologue:
Tbr1
Mouse Description:
T-box brain gene 1 Gene [Source:MGI Symbol;Acc:MGI:107404]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10845 Nonsense Available for shipment Available now
sa34772 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41554 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10845
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006612 Nonsense 173 676 1 6
ENSDART00000125742   None 437 None 7
Genomic Location (Zv9):
Chromosome 9 (position 52782324)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 51975685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATTGAGCAACTCTTCTCCGCAAGGTYACGCGACCGCCGGGTACCCGTA[C/A]GCGCAACAGTATGGACACGCGTACCAGGGCACGGCTTTCTACCAGTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34772
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006612 Essential Splice Site 373 676 4 6
ENSDART00000125742 Essential Splice Site 135 437 3 7
ENSDART00000006612 Essential Splice Site 373 676 4 6
ENSDART00000125742 Essential Splice Site 135 437 3 7
Genomic Location (Zv9):
Chromosome 9 (position 52780402)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 51973763
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCCCCGAGACGCAGTTCATTGCTGTCACCGCATATCAAAACACTGAT[G/A]TAAGAGAAAGAGAATTGTGTTGATAATTCGGTTGATTTGTGGAATATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41554
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006612 Essential Splice Site 373 676 4 6
ENSDART00000125742 Essential Splice Site 135 437 3 7
ENSDART00000006612 Essential Splice Site 373 676 4 6
ENSDART00000125742 Essential Splice Site 135 437 3 7
Genomic Location (Zv9):
Chromosome 9 (position 52780402)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 51973763
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCCCCGAGACGCAGTTCATTGCTGTCACCGCATATCAAAACACTGAT[G/A]TAAGAGAAAGAGAATTGTGTTGATAATTCGGTTGATTTGTGGAATATTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link