tbr1b

Ensembl ID:
ENSDARG00000004712
ZFIN IDs:
ZDB-GENE-000323-1, ZDB-GENE-000323-1
Description:
T-box brain protein 1 [Source:RefSeq peptide;Acc:NP_001108562]
Human Orthologue:
TBR1
Human Description:
T-box, brain, 1 [Source:HGNC Symbol;Acc:11590]
Mouse Orthologue:
Tbr1
Mouse Description:
T-box brain gene 1 Gene [Source:MGI Symbol;Acc:MGI:107404]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10845 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10845
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006612 Nonsense 173 676 1 6
ENSDART00000125742 None None 437 None 7
Genomic Location:
Chromosome 9 (position 52782324)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATTGAGCAACTCTTCTCCGCAAGGTYACGCGACCGCCGGGTACCCGTA[C/A]GCGCAACAGTATGGACACGCGTACCAGGGCACGGCTTTCTACCAGTTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ltx4k71a