irf2bp2a

Ensembl ID:
ENSDARG00000004702
ZFIN ID:
ZDB-GENE-030131-7809
Description:
Interferon regulatory factor 2-binding protein 2-A [Source:UniProtKB/Swiss-Prot;Acc:Q6NZT6]
Human Orthologue:
IRF2BP2
Human Description:
interferon regulatory factor 2 binding protein 2 [Source:HGNC Symbol;Acc:21729]
Mouse Orthologue:
Irf2bp2
Mouse Description:
interferon regulatory factor 2 binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2443921]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35596 Nonsense Mutation detected in F1 DNA During 2017
sa950 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa35596
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025126 Nonsense 74 491 1 2
ENSDART00000136991 Nonsense 74 263 1 2
Genomic Location (Zv9):
Chromosome 13 (position 50422490)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 49153528
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAAGAGCGCATGGATTTCAGGACGGCAGACCGGCGGGGCCGGGGAAA[C/T]AGTTACCGGGGAAGGAGATCCACGCGTCGGGAGACCCGGGCTCGCGCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa950
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025126 Nonsense 240 491 1 2
ENSDART00000136991 Nonsense 240 263 1 2
Genomic Location (Zv9):
Chromosome 13 (position 50421992)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 49153030
KASP Assay ID:
554-0855.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATGACGCTCAACCCGTACGACGGCAGATTCAAGAAGGAGCACATGCAG[C/T]AGAGGGTCATGTACGAGACTGGTCCTGCATCCAAATCAGGTATGCTATTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Life threatening arrhythmia: Genome-wide association of implantable cardioverter-defibrillator activation with life-threatening arrhythmias. (View Study)
  • Schizophrenia: Genome-wide association study in a Swedish population yields support for greater CNV and MHC involvement in schizophrenia compared with bipolar disorder. (View Study)
  • Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link