acaa1

Ensembl ID:
ENSDARG00000004687
ZFIN ID:
ZDB-GENE-040704-48
Description:
3-ketoacyl-CoA thiolase B, peroxisomal [Source:RefSeq peptide;Acc:NP_001002207]
Human Orthologue:
ACAA1
Human Description:
acetyl-CoA acyltransferase 1 [Source:HGNC Symbol;Acc:82]
Mouse Orthologues:
Acaa1a, Acaa1b
Mouse Descriptions:
acetyl-Coenzyme A acyltransferase 1A Gene [Source:MGI Symbol;Acc:MGI:2148491]
acetyl-Coenzyme A acyltransferase 1B Gene [Source:MGI Symbol;Acc:MGI:3605455]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11166 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11166
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007997 Essential Splice Site 128 418 4 12
Genomic Location:
Chromosome 24 (position 20935292)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAAACAGGCAGTGCTCCTCTGGACTACAGGCACTTTTTAATATTGCAG[G/A]TAASAATGACATTAAAGCTGTAAAAYGGCYCACTCYTAATAGGGTACAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n8auoyl7