ptk2.1

Ensembl ID:
ENSDARG00000004672
ZFIN ID:
ZDB-GENE-020114-1
Description:
focal adhesion kinase 1 [Source:RefSeq peptide;Acc:NP_571871]
Human Orthologue:
PTK2
Human Description:
PTK2 protein tyrosine kinase 2 [Source:HGNC Symbol;Acc:9611]
Mouse Orthologue:
Ptk2
Mouse Description:
PTK2 protein tyrosine kinase 2 Gene [Source:MGI Symbol;Acc:MGI:95481]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22876 Nonsense Available for shipment Available now
sa22875 Nonsense Available for shipment Available now
sa36174 Nonsense Mutation detected in F1 DNA During 2017
sa36173 Essential Splice Site Mutation detected in F1 DNA During 2017
sa22874 Essential Splice Site Available for shipment Available now
sa13179 Essential Splice Site Available for shipment Available now
sa22873 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22876
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042716 Nonsense 69 1050 4 32
ENSDART00000122474 Nonsense 107 1088 3 31
ENSDART00000128158   None 280 4 14
ENSDART00000130249   None 280 4 14

The following transcripts of ENSDARG00000004672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 33126041)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30864556
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATACTGTACATGTTGTCACTCGTATATTTGTGTTTTCAGGGCATTATA[C/T]AGAAGATTTTAGACATCCATAAGGTGAGGTGCGTGTCCTGCTTCGGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22875
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042716 Nonsense 112 1050 4 32
ENSDART00000122474 Nonsense 150 1088 3 31
ENSDART00000128158 Nonsense 11 280 4 14
ENSDART00000130249 Nonsense 11 280 4 14

The following transcripts of ENSDARG00000004672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 33125912)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30864427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATTGGCTTCATCCAGACATGGGCGTTTCTCATGTGAGGGAGAGGTAC[G/T]AGCACAGCCATCCACAGGACGACTGGAGGTGAGTCACTGTTTTAATGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36174
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042716 Nonsense 155 1050 6 32
ENSDART00000122474 Nonsense 193 1088 5 31
ENSDART00000128158 Nonsense 54 280 6 14
ENSDART00000130249 Nonsense 54 280 6 14

The following transcripts of ENSDARG00000004672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 33118110)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30856625
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGTCTGGTGGTCTAATATTTCTCTATGTGTCCAGGTGAAAAGCGATTA[T/A]ATGATGGAGATTGCAGATCAAGTTGATCAAGACATAGCACTTAAACTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36173
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042716 Essential Splice Site 395 1050 15 32
ENSDART00000122474 Essential Splice Site 433 1088 14 31
ENSDART00000128158   None 280 None 14
ENSDART00000130249   None 280 None 14

The following transcripts of ENSDARG00000004672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 33104107)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30842622
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAGCTGCTCCTGCTGCGCTTGGACTTAAAATACTGTTTTTCCCTTTTC[A/G]GAAACGGACGACTACGCTGAGATCATAGACGAAGAGGACACTTACACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22874
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042716 Essential Splice Site 581 1050 None 32
ENSDART00000122474 Essential Splice Site 619 1088 None 31
ENSDART00000128158   None 280 None 14
ENSDART00000130249   None 280 None 14

The following transcripts of ENSDARG00000004672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 33091424)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30829939
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGACTTTGGGTTGTCGAGATACATGGAGGACAGTTCTTATTATAAAGG[T/C]ATTGTGGCACTGTCAGCATATGCTTATTTGGAAGAAATTAAACTTTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13179
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042716 Essential Splice Site 795 1050 None 32
ENSDART00000122474 Essential Splice Site 833 1088 None 31
ENSDART00000128158   None 280 None 14
ENSDART00000130249   None 280 None 14

The following transcripts of ENSDARG00000004672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 33060833)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30799348
KASP Assay ID:
2260-9863.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGNNNNNTTGGTTGTGGTGTGTTTTAGCATRYGTTGATGAGAGTTTTGTGTTTC[A/T]GGATGRTGTGGCTCTGCGTGGAGGTCTGTCTCAGCTGATGGAGGARCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22873
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042716 Essential Splice Site 902 1050 30 32
ENSDART00000122474 Essential Splice Site 940 1088 29 31
ENSDART00000128158   None 280 None 14
ENSDART00000130249   None 280 None 14

The following transcripts of ENSDARG00000004672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 33044304)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30782819
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATCTTCATTAATCCATCATTTAAAAAAACTTGTATATGTTCTTGTCTA[G/T]ATTCAGCCTCAGGAGATCAATCCACCACCAACGGCTAACTTGGATCGCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link