kctd16a

Ensembl ID:
ENSDARG00000004648
ZFIN ID:
ZDB-GENE-060117-1
Description:
potassium channel tetramerisation domain containing 16a [Source:RefSeq peptide;Acc:NP_001032315]
Human Orthologue:
KCTD16
Human Description:
potassium channel tetramerisation domain containing 16 [Source:HGNC Symbol;Acc:29244]
Mouse Orthologue:
Kctd16
Mouse Description:
potassium channel tetramerisation domain containing 16 Gene [Source:MGI Symbol;Acc:MGI:1914659]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13200 Nonsense Available for shipment Available now
sa35689 Nonsense Mutation detected in F1 DNA During 2016
sa1375 Nonsense Available for shipment Available now
sa42391 Nonsense Mutation detected in F1 DNA During 2016
sa16517 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13200
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014411 Nonsense 143 285 1 1
ENSDART00000130103 Nonsense 143 412 1 2
Genomic Location (Zv9):
Chromosome 14 (position 24716493)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 23515017
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATAGTCACAGTGATTTTGACGAAGCATCCCAGGGAAGCGACCAGAGGT[T/A]ATATCCAGCCTCTTACCTGGAMGCGCGCGACCGACGCTACGGCTTCATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35689
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014411 Nonsense 187 285 1 1
ENSDART00000130103 Nonsense 187 412 1 2
Genomic Location (Zv9):
Chromosome 14 (position 24716624)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 23515148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGGACACTGATCCCAAAGCCCGCGGAATACCCAAAATCTTCATTTGC[G/T]GAAGAGTCGGTCTGGCGAAAGAAGTTTTCGGCGACGCACTAAACGAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1375
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014411 Nonsense 218 285 1 1
ENSDART00000130103 Nonsense 218 412 1 2
Genomic Location (Zv9):
Chromosome 14 (position 24716719)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 23515243
KASP Assay ID:
554-1287.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGCCGGGATCCTGACAGACYGCCGGAGCGTTACACTTCTCAGTTTTA[C/A]CTGAAGTTTCGCCACCTGGAGCGAGCGTTTGATATGCTCGCGGAGAGCGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa42391
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014411 Nonsense 226 285 1 1
ENSDART00000130103 Nonsense 226 412 1 2
Genomic Location (Zv9):
Chromosome 14 (position 24716741)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 23515265
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCGGAGCGTTACACTTCTCAGTTTTACCTGAAGTTTCGCCACCTGGAG[C/T]GAGCGTTTGATATGCTCGCGGAGAGCGGGTTCCACATCGTCGCGTGCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16517
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014411   None 285 None 1
ENSDART00000130103 Nonsense 410 412 2 2
Genomic Location (Zv9):
Chromosome 14 (position 24753558)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 23552082
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CKTTTTCCGGAGAGGAAGTACATGTGGCAGTCGGAGCTCTTGAAAAAATA[T/A]CAGCTCTGAAATGATTTCCTGCAGGCTCGCTGGRCCTWTTAGAGCGACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link