cdhr1

Ensembl ID:
ENSDARG00000004643
ZFIN ID:
ZDB-GENE-040924-4
Description:
Cadherin-related family member 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6B3P0]
Human Orthologues:
CDH23, CDHR1
Human Descriptions:
cadherin-related 23 [Source:HGNC Symbol;Acc:13733]
cadherin-related family member 1 [Source:HGNC Symbol;Acc:14550]
Mouse Orthologue:
Cdhr1
Mouse Description:
cadherin-related family member 1 Gene [Source:MGI Symbol;Acc:MGI:2157782]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9596 Essential Splice Site Available for shipment Available now
sa35513 Nonsense Mutation detected in F1 DNA During 2016
sa15425 Nonsense Available for shipment Available now
sa1445 Nonsense F2 line generated During 2016
sa9583 Nonsense Available for shipment Available now
sa35512 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa9596
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026679 Essential Splice Site 119 856 4 17
ENSDART00000110005 Essential Splice Site 120 857 5 18
Genomic Location (Zv9):
Chromosome 13 (position 29726158)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29372106
KASP Assay ID:
2260-6529.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAAGATGAGATTGAAGTCTTTGTCAGCATCTCTGATAGCCTTAATAAA[G/A]TAAGTATTACGACTGRKTAAGGACTCGTATATCAGTACCAGAGATGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35513
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026679 Nonsense 134 856 5 17
ENSDART00000110005 Nonsense 135 857 6 18
Genomic Location (Zv9):
Chromosome 13 (position 29726038)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29371986
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGTCAGGTAGTTGAAAAGGTTTCAGTTTTTATCATGGATGCCAATGAT[G/T]AGAGACCACAGTTTCAAAACATGCCTTCCATCGTAGATGTGCCAGAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15425
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026679 Nonsense 229 856 8 17
ENSDART00000110005 Nonsense 230 857 9 18
Genomic Location (Zv9):
Chromosome 13 (position 29722989)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29368937
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AWAAATTATTKYGTTTTTAGGATGGAGGAGGCATTTACAAGGGCAAGCAA[C/T]AAGTGATGTCATCATCTGCTACTTTGACCATAAATGTGATCGACACTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1445
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026679 Nonsense 276 856 9 17
ENSDART00000110005 Nonsense 277 857 10 18
Genomic Location (Zv9):
Chromosome 13 (position 29721308)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29367256
KASP Assay ID:
554-1371.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAGATCTAATTTTGTCTACAGGGATCTGAGATATTTACAGTTTCTGCC[A/T]AAGATGGAGACATGGATAATCCAAATACGATCATATATTCATTGGACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9583
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026679 Nonsense 439 856 12 17
ENSDART00000110005 Nonsense 440 857 13 18
Genomic Location (Zv9):
Chromosome 13 (position 29719878)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29365826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAGTCACYGTCCTAGTGGAGGATTCTGCWGCAATGGATTTTGAGAAAT[C/A]ACAGTTCCTGACTTTTAAGGTAGAAKTTTTTTYGTTTCACAGCTGTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35512
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026679 Nonsense 552 856 15 17
ENSDART00000110005 Nonsense 553 857 16 18
Genomic Location (Zv9):
Chromosome 13 (position 29709493)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29355441
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCCTTGGGCCAGTCTGGATGCTGAGGTCAAATCCAAGTATAACTTCTA[C/A]GTGAAAGCCGAAGACCCTGAAGGAAAATACAGCCTCGCGGAAGTCTTTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Vitiligo: Association analyses identify three susceptibility Loci for vitiligo in the Chinese Han population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link