epha7

Ensembl ID:
ENSDARG00000004635
ZFIN ID:
ZDB-GENE-030131-3745
Description:
ephrin type-A receptor 7 [Source:RefSeq peptide;Acc:NP_001038444]
Human Orthologue:
EPHA7
Human Description:
EPH receptor A7 [Source:HGNC Symbol;Acc:3390]
Mouse Orthologue:
Epha7
Mouse Description:
Eph receptor A7 Gene [Source:MGI Symbol;Acc:MGI:95276]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23700 Essential Splice Site Available for shipment Available now
sa37024 Essential Splice Site Mutation detected in F1 DNA During 2016
sa43437 Nonsense Mutation detected in F1 DNA During 2016
sa3066 Essential Splice Site F2 line generated During 2016
sa12035 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23700
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102788 Essential Splice Site 277 1016 3 18
Genomic Location (Zv9):
Chromosome 20 (position 24989216)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25060519
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGTATATGCAAAGCTGGATTTCACCAGAAGGGAGATGCATGTGAACG[T/C]GAGTACTTTATTTTCATTTGCACAAATCTGTTGGCATGTATTAGAACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37024
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102788 Essential Splice Site 659 1016 11 18
Genomic Location (Zv9):
Chromosome 20 (position 24871149)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24942452
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAGAGCTGGACGCCTCCTGCATTAAGATTGAGAGGGTTATCGGCGCAG[G/A]TGAGCTCTTTTCTTGTCTTCTCCGCTGCCTCGCTTTAGTCGCACACCTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43437
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102788 Nonsense 949 1016 17 18
Genomic Location (Zv9):
Chromosome 20 (position 24851148)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24922451
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGACCAGAACACTCCAGATTTCACCTCTTTCCGATTGGTCAGCGAGTG[G/A]TTGGAAGCCATCAAGATGGAGAGATACATGGACAACTTCACAGCCGCCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3066
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102788 Essential Splice Site 979 1016 17 18
Genomic Location (Zv9):
Chromosome 20 (position 24851057)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24922360
KASP Assay ID:
554-2847.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CMGCCGCCGGCTACAGCTCGCTTGAATCTGTGGCTCGAATGACTATCGAG[T/C]AAGAGCTCTGATMCCTCGCTCACACTGTCACGCTCCACAGAAATGCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12035
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102788 Nonsense 1007 1016 18 18
Genomic Location (Zv9):
Chromosome 20 (position 24850717)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24922020
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATCAGAAGAAGATCATGAGCAGTATACAGACTATGAGAGCGCAGATGT[T/A]GCATCTTCACGGGACRGGCGTTCAAGTGTGATGGGCAYCCACARCCCCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link