si:ch211-149g8.3

Ensembl ID:
ENSDARG00000004634
ZFIN ID:
ZDB-GENE-090312-18
Description:
oxysterol-binding protein 1 [Source:RefSeq peptide;Acc:NP_001139057]
Human Orthologue:
OSBP
Human Description:
oxysterol binding protein [Source:HGNC Symbol;Acc:8503]
Mouse Orthologue:
Osbp
Mouse Description:
oxysterol binding protein Gene [Source:MGI Symbol;Acc:MGI:97447]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38299 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38299
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031301 Nonsense 249 760 5 15
ENSDART00000141530 Nonsense 249 760 6 16
Genomic Location (Zv9):
Chromosome 1 (position 53171183)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 52041782
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGGCTGGAGGAGACGCTGGAGCAGCTCGCCAAACAACACAACCATCTA[G/T]AAAGAGCCTTCAGGGGAGCCACTGTCCTGCCTCCATCACAGAGCAACCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link