gpm6ab

Ensembl ID:
ENSDARG00000004621
ZFIN ID:
ZDB-GENE-030710-8
Description:
glycoprotein M6Ab [Source:RefSeq peptide;Acc:NP_999852]
Human Orthologue:
GPM6A
Human Description:
glycoprotein M6A [Source:HGNC Symbol;Acc:4460]
Mouse Orthologue:
Gpm6a
Mouse Description:
glycoprotein m6a Gene [Source:MGI Symbol;Acc:MGI:107671]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38279 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38279
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040280 Essential Splice Site 203 250 None 7
ENSDART00000128794 Essential Splice Site 214 285 None 7
ENSDART00000130324 Essential Splice Site 202 249 None 6

The following transcripts of ENSDARG00000004621 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 39010011)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 37937273
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACCATCCTCATTCTCTCCTCTTCACAATCTTTTTTTGTCTCTTTCTCC[A/G]GCTGGATCTGACGTTCCACTTGTTTGTCTGCGCTCTTGCGGGGGCTGGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link