mtmr2

Ensembl ID:
ENSDARG00000004616
ZFIN ID:
ZDB-GENE-990715-14
Description:
Myotubularin-related protein 2 [Source:UniProtKB/Swiss-Prot;Acc:A0JMK5]
Human Orthologue:
MTMR2
Human Description:
myotubularin related protein 2 [Source:HGNC Symbol;Acc:7450]
Mouse Orthologue:
Mtmr2
Mouse Description:
myotubularin related protein 2 Gene [Source:MGI Symbol;Acc:MGI:1924366]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7329 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7329
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020004 Nonsense 262 620 10 16
ENSDART00000122563 Nonsense 210 568 7 13
Genomic Location:
Chromosome 5 (position 25284922)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTTTCATGGATCCAYCCKGAGAGTCAGGCTGCGGTGGTTCGCTCCAGT[C/T]AGCCAATGGTGGGCCAGAAYGGACGACGCTGCAAAGAGGATGAGAAGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zecbj3k6