mtmr2

Ensembl ID:
ENSDARG00000004616
ZFIN ID:
ZDB-GENE-990715-14
Description:
Myotubularin-related protein 2 [Source:UniProtKB/Swiss-Prot;Acc:A0JMK5]
Human Orthologue:
MTMR2
Human Description:
myotubularin related protein 2 [Source:HGNC Symbol;Acc:7450]
Mouse Orthologue:
Mtmr2
Mouse Description:
myotubularin related protein 2 Gene [Source:MGI Symbol;Acc:MGI:1924366]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7329 Nonsense Mutation detected in F1 DNA During 2015
sa26459 Essential Splice Site Mutation detected in F1 DNA During 2015
sa26458 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa7329
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020004 Nonsense 262 620 10 16
ENSDART00000122563 Nonsense 210 568 7 13
Genomic Location:
Chromosome 5 (position 25284922)
KASP Assay ID:
554-4207.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTTTCATGGATCCAYCCKGAGAGTCAGGCTGCGGTGGTTCGCTCCAGT[C/T]AGCCAATGGTGGGCCAGAAYGGACGACGCTGCAAAGAGGATGAGAAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26459
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020004 Essential Splice Site 507 620 14 16
ENSDART00000122563 Essential Splice Site 455 568 11 13
Genomic Location:
Chromosome 5 (position 25282032)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTATTTGGCACGTTTCTGTGTAACAGTGAACAGCAAAGACTCAAAGAAG[T/A]AAGTGCAAACGTACTATTGGACATATCTGCAATAGGAACATCAAAGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26458
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020004 Nonsense 524 620 15 16
ENSDART00000122563 Nonsense 472 568 12 13
Genomic Location:
Chromosome 5 (position 25280407)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAATCCCGAAGCGCACTGTCTCTCTCTGGTCATTTGTGAACAGTCAGT[T/A]GGAGGAGTTTGTGAATCCGCTGTACGTGCACTACTCTTCTCATGTGCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zecbj3k6