A0JMG7_DANRE

Ensembl ID:
ENSDARG00000004594
Description:
LOC568719 protein [Source:UniProtKB/TrEMBL;Acc:A0JMG7]
Human Orthologue:
ZNF800
Human Description:
zinc finger protein 800 [Source:HGNC Symbol;Acc:27267]
Mouse Orthologue:
Zfp800
Mouse Description:
zinc finger protein 800 Gene [Source:MGI Symbol;Acc:MGI:1889334]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9670 Essential Splice Site Available for shipment Available now
sa38091 Nonsense Mutation detected in F1 DNA During 2016
sa15881 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9670
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098307 Essential Splice Site 87 805 2 7
Genomic Location (Zv9):
Chromosome 25 (position 27768115)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 26458209
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCGCCTTCTACCATCTTTACTCGAAAGCGAACGTTGTTTTTACACGAG[G/A]TAAGAACTCCGTGAACACATCTCAGCCGATTTCAACCGCGGGAGTTGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38091
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098307 Nonsense 125 805 3 7
Genomic Location (Zv9):
Chromosome 25 (position 27771237)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 26461331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGACTAGTGACAAATACTGCCAGACTGAGACACTTCAGGCCTGCTGTTG[C/A]CAAACAACAGAAACCCCTCAAGAGCCTTGTGGCAAAAATCCAGGTAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15881
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098307 Nonsense 341 805 6 7
Genomic Location (Zv9):
Chromosome 25 (position 27775110)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 26465204
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTAATGAAGGTCCRAGCTGCGATGAGCAAATGAAGATKGAAGGGGAG[G/T]AAGAGGAAGAGGAGAGTGCAGCCTCAGAAGKAAAAGAATTGAGGATCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link