A0JMG7_DANRE

Ensembl ID:
ENSDARG00000004594
Description:
LOC568719 protein [Source:UniProtKB/TrEMBL;Acc:A0JMG7]
Human Orthologue:
ZNF800
Human Description:
zinc finger protein 800 [Source:HGNC Symbol;Acc:27267]
Mouse Orthologue:
Zfp800
Mouse Description:
zinc finger protein 800 Gene [Source:MGI Symbol;Acc:MGI:1889334]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9670 Essential Splice Site Available for shipment Available now
sa15881 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9670
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098307 Essential Splice Site 87 805 2 7
Genomic Location:
Chromosome 25 (position 27768115)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCGCCTTCTACCATCTTTACTCGAAAGCGAACGTTGTTTTTACACGAG[G/A]TAAGAACTCCGTGAACACATCTCAGCCGATTTCAACCGCGGGAGTTGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15881
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098307 Nonsense 341 805 6 7
Genomic Location:
Chromosome 25 (position 27775110)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTAATGAAGGTCCRAGCTGCGATGAGCAAATGAAGATKGAAGGGGAG[G/T]AAGAGGAAGAGGAGAGTGCAGCCTCAGAAGKAAAAGAATTGAGGATCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vtcg2hii