ntrk1

Ensembl ID:
ENSDARG00000004586
ZFIN ID:
ZDB-GENE-980526-118
Description:
Tyrosine-protein kinase receptor [Source:UniProtKB/TrEMBL;Acc:B3DGZ3]
Human Orthologue:
NTRK1
Human Description:
neurotrophic tyrosine kinase, receptor, type 1 [Source:HGNC Symbol;Acc:8031]
Mouse Orthologue:
Ntrk1
Mouse Description:
neurotrophic tyrosine kinase, receptor, type 1 Gene [Source:MGI Symbol;Acc:MGI:97383]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32109 Essential Splice Site Available for shipment Available now
sa14939 Essential Splice Site Available for shipment Available now
sa14955 Nonsense Available for shipment Available now
sa36252 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32109
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027013   None 619 None 13
ENSDART00000125908 Essential Splice Site 25 733 2 15
ENSDART00000128068 Essential Splice Site 85 782 3 16
Genomic Location (Zv9):
Chromosome 16 (position 48906960)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45876181
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTGGGTGGACACACAAAAGAAAGGTTAATGCTTTTCTTGTTTGTTTC[A/T]GGACGATCACAGATTGTGGGTTGGTGTACATCTCTGAAAATGCCTTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14939
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027013 Essential Splice Site 52 619 2 13
ENSDART00000125908 Essential Splice Site 170 733 5 15
ENSDART00000128068 Essential Splice Site 230 782 6 16
Genomic Location (Zv9):
Chromosome 16 (position 48896625)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45865846
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGACGATCCACTGGAGAACTGAGCRSCTTCGGTCCRGCTGGAYCCTRGAG[G/A]TACATGAGACATCTATGGAAACTGACSATATAAGTATATCACTGGATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14955
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027013 Nonsense 58 619 3 13
ENSDART00000125908 Nonsense 176 733 6 15
ENSDART00000128068 Nonsense 236 782 7 16
Genomic Location (Zv9):
Chromosome 16 (position 48895098)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45864319
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCAGACAGTTAAACCTGTACTGTTGTCCACAGCAWGGAATCTKGGGAT[C/A]AACCCTGGAGGTGRTTCTGCACATGAGRAAYGTGTCTTCTGCTGACAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36252
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027013 Essential Splice Site 209 619 4 13
ENSDART00000125908 Essential Splice Site 327 733 7 15
ENSDART00000128068 Essential Splice Site 387 782 8 16
Genomic Location (Zv9):
Chromosome 16 (position 48885930)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45855151
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCATGGACAATCCTTTTGATCCCTCTGACCCGGAGGGCATCATCCCTG[G/A]TGAGGGCACTTCATCTAAATTATATTACACCAACTGTGTGGTGCATTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link