si:ch211-245h14.3

Ensembl ID:
ENSDARG00000004574
ZFIN ID:
ZDB-GENE-041014-349
Description:
general transcription factor 3C polypeptide 2 [Source:RefSeq peptide;Acc:NP_001038483]
Human Orthologue:
GTF3C2
Human Description:
general transcription factor IIIC, polypeptide 2, beta 110kDa [Source:HGNC Symbol;Acc:4665]
Mouse Orthologue:
Gtf3c2
Mouse Description:
general transcription factor IIIC, polypeptide 2, beta Gene [Source:MGI Symbol;Acc:MGI:1919002]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13164 Nonsense Available for shipment Available now
sa39298 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13164
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020969 Nonsense 349 853 8 19
ENSDART00000101262 Nonsense 348 830 8 18
ENSDART00000145254   None 138 None 2
Genomic Location (Zv9):
Chromosome 20 (position 38577790)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38650202
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTTCGGRCCATGGAATGGTGCCCGTGTCCAGAYGGGGCWGAGAAAAAA[C/T]AATATGCTGCCATCTACTGCCATAAAGGCATGGACGACACACACCAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39298
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020969 Essential Splice Site 649 853 16 19
ENSDART00000101262 Essential Splice Site 626 830 15 18
ENSDART00000145254   None 138 None 2
Genomic Location (Zv9):
Chromosome 20 (position 38598562)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38670974
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAAGATTAATGATGAATCCATAATAATGACAAAGCTATTCTCTTTTTC[A/T]GAGCCTTTCTATGTCCGATTGGATAAATGCATTTGCCATTGTGGATAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link