ptgs2a

Ensembl ID:
ENSDARG00000004539
ZFIN ID:
ZDB-GENE-020530-2
Description:
prostaglandin-endoperoxide synthase 2 [Source:RefSeq peptide;Acc:NP_705943]
Human Orthologue:
PTGS2
Human Description:
prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) [Source:HGNC S
Mouse Orthologue:
Ptgs2
Mouse Description:
prostaglandin-endoperoxide synthase 2 Gene [Source:MGI Symbol;Acc:MGI:97798]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11800 Nonsense Available for shipment Available now
sa16633 Nonsense Available for shipment Available now
sa90 Nonsense Confirmed mutation in F2 line During 2017
sa25105 Nonsense Mutation detected in F1 DNA During 2017
sa10104 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11800
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006870 Nonsense 14 601 1 9
Genomic Location (Zv9):
Chromosome 2 (position 20719755)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21265693
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTCTGGAATGAATAAACTGGTTTGCTTGGTCCTACTTTCAAGCATTTG[G/A]ATCTTTCCTGGTGAAGGATGTAAGTTAAAACAAATTTMCTCTGTTAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16633
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006870 Nonsense 104 601 3 9
Genomic Location (Zv9):
Chromosome 2 (position 20719285)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21265223
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGATATCATCAACAGCATCTCTTACCTGAGGGATGGCATAATGCGCTA[T/A]ATCCTSTTGTGTAAGTTGAATGAAATCACTTCWGCATTGGATTTCCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa90
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006870 Nonsense 162 601 4 9
Genomic Location (Zv9):
Chromosome 2 (position 20719002)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21264940
KASP Assay ID:
554-0067.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAAAACTGCCCAACGCCTGATCTCCCAAATGCCAAGCAGGTGGTGGAG[C/T]AGGTGCTGTTGAGGAAGCAGTTCATCCCTGATCCACAGAGGAGCAGTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25105
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006870 Nonsense 218 601 5 9
Genomic Location (Zv9):
Chromosome 2 (position 20718752)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21264690
KASP Assay ID:
554-7831.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTAAAGATTCTGTCGTGTTTTAGGTGGATCTGGGGCATATTTATGGA[G/T]AGACGCTGGAGGTTCAACACAAACTTCGTCTGTTTAAAGATGGAAAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10104
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006870 Nonsense 527 601 9 9
Genomic Location (Zv9):
Chromosome 2 (position 20712983)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21258921
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTCTCTCAAAGGCCTCATGGGAAATGCTATTTGTTCTCCTGAATACTG[G/A]AAGCCCAGCACATTTGGTGGGAAAGTRGGATTTGACATCGTTAACTCKGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Knee osteoarthritis: Genome-wide association scan identifies a prostaglandin-endoperoxide synthase 2 variant involved in risk of knee osteoarthritis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link