mll

Ensembl ID:
ENSDARG00000004537
ZFIN ID:
ZDB-GENE-080521-3
Description:
histone-lysine N-methyltransferase MLL [Source:RefSeq peptide;Acc:NP_001103749]
Human Orthologue:
MLL
Human Description:
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) [Source:HGNC Symbol;Acc:7
Mouse Orthologue:
Mll1
Mouse Description:
myeloid/lymphoid or mixed-lineage leukemia 1 Gene [Source:MGI Symbol;Acc:MGI:96995]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42541 Nonsense Mutation detected in F1 DNA During 2016
sa137 Nonsense Confirmed mutation in F2 line During 2016
sa24984 Nonsense Mutation detected in F1 DNA During 2016
sa35881 Essential Splice Site Mutation detected in F1 DNA During 2016
sa19111 Nonsense Mutation detected in F1 DNA During 2016
sa10905 Nonsense Available for shipment Available now
sa22638 Nonsense Available for shipment Available now
sa2815 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa42541
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104525 Nonsense 1664 4219 10 35
Genomic Location (Zv9):
Chromosome 15 (position 22753340)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23464527
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCCTTCCATCTCTTCTGCTTGGGGGAGGCAGAGCGGCCTCATGACGAA[C/T]AGTGGGAAAACTGGTGTTGCCGCCGATGCCGCTTTTGCCATGTTTGTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa137
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104525 Nonsense 1668 4219 10 35
Genomic Location (Zv9):
Chromosome 15 (position 22753326)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23464513
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGCTTGGGGGAGGCAGAGCGGCCTCATGACGAACAGTGGGAAAACTG[G/A]TGTTGCCGCCGATGCCGCTTTTGCCATGTTTGTGGGCGGAAATATCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24984
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104525 Nonsense 1762 4219 13 35
Genomic Location (Zv9):
Chromosome 15 (position 22751237)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23462424
KASP Assay ID:
554-7410.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTGTCATTAAACAATGTAATAAATGTTATTTCCCCCTTCCAGGCAACT[T/A]GTGCCCACTTTGTAATAAGGGCTATGATGACGATGACTGTGACAGCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35881
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104525 Essential Splice Site 1954 4219 16 35
Genomic Location (Zv9):
Chromosome 15 (position 22748257)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23459444
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTAGAGAGCAGGAAAGCCAACAGCATGCTCAAGTCCTTTTTTATTCGG[G/A]TGAGAAAAAGCTGGTGGACACACAGTTCTGACAGTTGGGTGTCTCGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19111
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104525 Nonsense 2976 4219 26 35
ENSDART00000104525 Nonsense 2976 4219 26 35
Genomic Location (Zv9):
Chromosome 15 (position 22741496)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23452683
KASP Assay ID:
2260-8460.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGTCTTCCATCTATTGCTGGTATTGATCAGTGTTTGGGAAGAGGTTCA[C/T]AGATCCACAGATTCTTGAGGGACCAGGCAAAGGAGCATGAAGATGACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10905
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104525 Nonsense 2976 4219 26 35
ENSDART00000104525 Nonsense 2976 4219 26 35
Genomic Location (Zv9):
Chromosome 15 (position 22741496)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23452683
KASP Assay ID:
2260-8460.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGYCTTCCATCTATTGCTGGTATTGATCAGTGTTTGGGAAGAGRTTCA[C/T]AGAWCCACAGATTCTTGAGGGACCAGGCAAAGGAGCATGAAGATGACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22638
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104525 Nonsense 3090 4219 26 35
Genomic Location (Zv9):
Chromosome 15 (position 22741154)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23452341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATCAAAAGGATAACTGTCTTCCATTAGGAAGTGTGAAAACACAAGGA[C/T]AAGACCCACTTGAAACTCAATTATCACTCACCACAGATCTGCTCAAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2815
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104525 Nonsense 4194 4219 35 35
Genomic Location (Zv9):
Chromosome 15 (position 22737015)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23448202
KASP Assay ID:
554-3171.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTTGCCACACGCAAGATCTATAAAGGCGAGGAGCTCACGTATGATTA[C/A]AAGTTTCCCATCGAAGAACCAGGCAATAAGCTGCCTTGCAACTGCGGGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link