si:ch211-284e20.6

Ensembl ID:
ENSDARG00000004502
ZFIN ID:
ZDB-GENE-050208-371
Description:
REST corepressor 3 [Source:RefSeq peptide;Acc:NP_001038494]
Human Orthologue:
RCOR3
Human Description:
REST corepressor 3 [Source:HGNC Symbol;Acc:25594]
Mouse Orthologue:
Rcor3
Mouse Description:
REST corepressor 3 Gene [Source:MGI Symbol;Acc:MGI:2441920]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29845 Nonsense Mutation detected in F1 DNA During 2017
sa25185 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa6146 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29845
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104498 Nonsense 172 551 6 14
ENSDART00000143792 Nonsense 172 547 6 12
Genomic Location (Zv9):
Chromosome 22 (position 41243219)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38330858
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTGTAGTTGCCGGACAAATCCATATCCAGTCTTGTAAAGTACTACTA[T/G]TCATGGAAGAAAACACGCTCCAGGACCAGCCTGATGGACCGGCAAGCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25185
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104498 Splice Site, Nonsense 201 551 7 14
ENSDART00000143792 Splice Site, Nonsense 201 547 7 12
Genomic Location (Zv9):
Chromosome 22 (position 41244429)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38332068
KASP Assay ID:
554-7396.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGTAGTGTTCCTGGTGCTCACTGTGTGTGTATTTCTGTGATATTAGT[G/T]AGGAGGAGATGGAAGAGGCTAACCCTGTGGAGGCCAACGACAGCGACTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6146
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104498 Essential Splice Site 228 551 7 14
ENSDART00000143792 Essential Splice Site 228 547 7 12
Genomic Location (Zv9):
Chromosome 22 (position 41244513)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38332152
KASP Assay ID:
554-3768.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAACGACAGCGACTATGACCCAACAAAAGAGGCAAAGAAGGAGGTAAAC[G/A]TGAGTTMATTACACACACATNACATCCAGAGCTGTGTTGGGGAATGTGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link