tspan33

Ensembl ID:
ENSDARG00000004497
ZFIN ID:
ZDB-GENE-040718-361
Description:
Tetraspanin-33 [Source:UniProtKB/Swiss-Prot;Acc:Q5RH71]
Human Orthologue:
TSPAN33
Human Description:
tetraspanin 33 [Source:HGNC Symbol;Acc:28743]
Mouse Orthologue:
Tspan33
Mouse Description:
tetraspanin 33 Gene [Source:MGI Symbol;Acc:MGI:1919012]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15665 Essential Splice Site Available for shipment Available now
sa3489 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15665
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002770 Essential Splice Site 195 281 None 8
ENSDART00000111882 Essential Splice Site 129 215 None 7
ENSDART00000148292 Essential Splice Site 129 160 None 6
Genomic Location:
Chromosome 4 (position 14032928)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAATTATTAGCACWTTAAATGTCCCTCTCTCCATCNTTTTTGTTTTGTC[A/T]GACTATAATAAACACCATGTGTGGTCATGGCATGCAGGCGCTGAATTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3489
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002770 Nonsense 261 281 8 8
ENSDART00000111882 Nonsense 195 215 7 7
ENSDART00000148292 None None 160 None 6
Genomic Location:
Chromosome 4 (position 14033292)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCTTTTTTCTAGCTGGTTGGAATCCTTCTCTCTCAGGTGCTTATTAAT[C/T]AAATCCAAGATCAAATTAAACTACAGAATTACAACCAACAACATCGCTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4tvbhz02