pcyt1ab

Ensembl ID:
ENSDARG00000004492
ZFIN ID:
ZDB-GENE-050522-114
Description:
phosphate cytidylyltransferase 1, choline, alpha b [Source:RefSeq peptide;Acc:NP_001018571]
Human Orthologue:
PCYT1A
Human Description:
phosphate cytidylyltransferase 1, choline, alpha [Source:HGNC Symbol;Acc:8754]
Mouse Orthologue:
Pcyt1a
Mouse Description:
phosphate cytidylyltransferase 1, choline, alpha isoform Gene [Source:MGI Symbol;Acc:MGI:88557]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13515 Nonsense Available for shipment Available now
sa23376 Nonsense Available for shipment Available now
sa9717 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13515
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027772 Nonsense 88 359 3 10
Genomic Location (Zv9):
Chromosome 18 (position 44436069)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46021563
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGTCCGGTACGCGTCTATGCTGATGGGATCTTTGACATGTTTCATTCG[G/T]GACACGCTCGGGCCTTAATGCAGGCYAAGTGCCTTTTCCCCAACACRTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23376
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027772 Nonsense 130 359 6 10
Genomic Location (Zv9):
Chromosome 18 (position 44432936)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
NNNNNNNNNNNNNNNNNNNNNNNNNNTGTCATGAATGAGGACGAGCGTTA[C/A]GATGCAGTGTGTCACTGTCGGTATGTGGATGAGGTCGTCCGCAATGCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9717
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027772 Nonsense 300 359 10 10
Genomic Location (Zv9):
Chromosome 18 (position 44426750)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46012244
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTCATRATGATCGACCTGATGTTTRATGTGTCCAACAGAAGCACATGT[T/A]GAAGGAGGGAAAAGGACGRATGTTACAGGCCATCAGTCCCAGACAGAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link