atat1

Ensembl ID:
ENSDARG00000004472
ZFIN ID:
ZDB-GENE-040426-2120
Description:
Alpha-tubulin N-acetyltransferase [Source:UniProtKB/Swiss-Prot;Acc:Q6PH17]
Human Orthologue:
ATAT1
Human Description:
alpha tubulin acetyltransferase 1 [Source:HGNC Symbol;Acc:21186]
Mouse Orthologue:
Atat1
Mouse Description:
alpha tubulin acetyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1913869]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9581 Nonsense Available for shipment Available now
sa12225 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9581
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049368 Nonsense 80 305 3 11
ENSDART00000103922 Nonsense 80 297 3 10
Genomic Location:
Chromosome 19 (position 27969934)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAGCTCCAGGCCAACAGACATCATCTCTACCTCCTGAAAGATGGAGAA[C/T]AGAACGGGTAMARTAGCTTTCTCTTTCTCCCCCACCCCATGCTTCAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12225
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049368 Essential Splice Site 139 305 5 11
ENSDART00000103922 Essential Splice Site 139 297 5 10
Genomic Location:
Chromosome 19 (position 27970395)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTACAAAGACATGGCTATGGCTCAGAGCTCTTCGACTTCATGCTRAAAG[T/C]GAGTYGTACGCATGATTTGTTGAATTACATGTGATTTTTACACAAWGTAR
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v9g80jtd