prkcsh

Ensembl ID:
ENSDARG00000004470
ZFIN ID:
ZDB-GENE-040426-770
Description:
glucosidase 2 subunit beta [Source:RefSeq peptide;Acc:NP_957347]
Human Orthologue:
PRKCSH
Human Description:
protein kinase C substrate 80K-H [Source:HGNC Symbol;Acc:9411]
Mouse Orthologue:
Prkcsh
Mouse Description:
protein kinase C substrate 80K-H Gene [Source:MGI Symbol;Acc:MGI:107877]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26138 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26138
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023814 Essential Splice Site 393 529 14 18
ENSDART00000133283   None 232 None 8
ENSDART00000136051   None 248 None 8
Genomic Location (Zv9):
Chromosome 3 (position 46825257)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 48834810
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATGCCAGTGTGCGAAGGTGAACGCTGTGTTGTTTTCCTTTGTGTTGCA[G/A]AAACATTGAAAAAGAGCTGTCCTTTGATTTTGGCCCTAACGCCGAGTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link