p2rx5

Ensembl ID:
ENSDARG00000004455
ZFIN ID:
ZDB-GENE-030319-5
Description:
P2X purinoceptor 5 [Source:RefSeq peptide;Acc:NP_919394]
Human Orthologue:
P2RX5
Human Description:
purinergic receptor P2X, ligand-gated ion channel, 5 [Source:HGNC Symbol;Acc:8536]
Mouse Orthologue:
P2rx5
Mouse Description:
purinergic receptor P2X, ligand-gated ion channel, 5 Gene [Source:MGI Symbol;Acc:MGI:2137026]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20513 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20513
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014404 Essential Splice Site 45 480 None 12
ENSDART00000097587 Essential Splice Site 45 479 None 14
Genomic Location (Zv9):
Chromosome 5 (position 43716357)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41497622
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTTCTGTTTAGACTCTTTCAGCTGACGGTGATCGGATATCTGATCGGG[T/C]AGGTGCCTTGTGCTTCTCTGAATCTAGACGTTAAGGTGAACGAACGGTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link