tnfrsfa

Ensembl ID:
ENSDARG00000004451
ZFIN ID:
ZDB-GENE-010802-1
Description:
tumor necrosis factor receptor superfamily, member a [Source:RefSeq peptide;Acc:NP_571915]
Human Orthologues:
TNFRSF10A, TNFRSF10B, TNFRSF10C, TNFRSF10D
Human Descriptions:
tumor necrosis factor receptor superfamily, member 10a [Source:HGNC Symbol;Acc:11904]
tumor necrosis factor receptor superfamily, member 10b [Source:HGNC Symbol;Acc:11905]
tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain [Sourc
tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain [Source:HG
Mouse Orthologue:
Tnfrsf10b
Mouse Description:
tumor necrosis factor receptor superfamily, member 10b Gene [Source:MGI Symbol;Acc:MGI:1341090]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7247 Missense, Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7247
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101920 Nonsense 315 435 10 12
ENSDART00000124871 Missense 317 436 8 10
Genomic Location:
Chromosome 21 (position 14378525)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTCAAATCATTGGGGATTCACCGCGATCCAGCCCCCCGGCCCAGAGAC[C/T]GACYGACAGAGATCAGACTGAATCATGGCCACGGGTTAGTGAGAWKAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xlcpc4hl