LOC568406

Ensembl ID:
ENSDARG00000004445
Human Orthologue:
GRM5
Human Description:
glutamate receptor, metabotropic 5 [Source:HGNC Symbol;Acc:4597]
Mouse Orthologue:
Grm5
Mouse Description:
glutamate receptor, metabotropic 5 Gene [Source:MGI Symbol;Acc:MGI:1351342]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17188 Nonsense Available for shipment Available now
sa9121 Nonsense Mutation detected in F1 DNA During 2014
sa24870 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17188
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042767 Nonsense 183 1177 1 8
Genomic Location:
Chromosome 10 (position 25848381)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGGTGCAGAATCTMCTGCAGCTCTTCAATATTCCCCAGATCGCGTATT[C/A]GGCAACCAGCATGGATCTCAGCGATAAGTCTTTGTATAAGTACTTCMTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9121
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042767 Nonsense 483 1177 5 8
Genomic Location:
Chromosome 10 (position 25878572)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGACGGTGCTTCTACKTGTTTTTCCAGGTATGAAATCAKGAACTTTAAA[C/T]AGAKGAGTGAAGAGGACTACAGCTACAWCCAYGTGGGCAGCTGGGACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24870
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042767 Nonsense 1000 1177 8 8
Genomic Location:
Chromosome 10 (position 25893515)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAACGTGCGCAAGTAGTAGCCATACCTTCATACCTAACCGAGCGTCTA[C/T]AACACCAACCATCCTCCATCATGGATCAAATCAGCTGCGTGGTCAGTCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7th8p6vq