fam92a1

Ensembl ID:
ENSDARG00000004436
ZFIN ID:
ZDB-GENE-040801-123
Description:
Protein FAM92A1 [Source:UniProtKB/Swiss-Prot;Acc:Q1LU86]
Human Orthologue:
FAM92A1
Human Description:
family with sequence similarity 92, member A1 [Source:HGNC Symbol;Acc:30452]
Mouse Orthologue:
Fam92a
Mouse Description:
family with sequence similarity 92, member A Gene [Source:MGI Symbol;Acc:MGI:1915349]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32249 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32249
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020301 Essential Splice Site 262 296 7 8
ENSDART00000114714 Essential Splice Site 261 295 8 9
ENSDART00000134045   None 162 None 4
ENSDART00000146559 Essential Splice Site 134 168 3 4
Genomic Location (Zv9):
Chromosome 19 (position 34627624)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 33675830
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCCTGAATCGAACTGGTACATCAATGAGTAAATCAGGAACAATGCAGG[T/C]AAGTACTTTCTACCAATAACTATTGCAGTGAAAAAGGTGGAAAAAACAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Temperament: A genome-wide meta-analysis of association studies of Cloninger's Temperament Scales. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link