btk

Ensembl ID:
ENSDARG00000004433
ZFIN ID:
ZDB-GENE-070531-1
Human Orthologue:
BTK
Human Description:
Bruton agammaglobulinemia tyrosine kinase [Source:HGNC Symbol;Acc:1133]
Mouse Orthologue:
Btk
Mouse Description:
Bruton agammaglobulinemia tyrosine kinase Gene [Source:MGI Symbol;Acc:MGI:88216]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13221 Essential Splice Site Available for shipment Available now
sa15417 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13221
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009758 Essential Splice Site 298 660 10 19
Genomic Location:
Chromosome 14 (position 40402353)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCAAGAACATCAACCGCAGTCAGGCAGAAAATTTACTAAAAACAGAAG[T/A]AAGTATGGAGCCGTGGTGGMACAATRACATGATTGGTTTATTAATGTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15417
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009758 Nonsense 462 660 15 19
Genomic Location:
Chromosome 14 (position 40393020)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTNCKGTAAACCTCTAGGAAACTCTGTCACGGAAACCTGGTACAGCTCTA[T/A]GGTGTGTGCACRAAACAAAGACCCATMTACATAGTCACAGAATATCTCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9v0wi4a5