dpy30

Ensembl ID:
ENSDARG00000004427
ZFIN ID:
ZDB-GENE-040718-136
Description:
dpy-30-like protein [Source:RefSeq peptide;Acc:NP_001002438]
Human Orthologue:
DPY30
Human Description:
dpy-30 homolog (C. elegans) [Source:HGNC Symbol;Acc:24590]
Mouse Orthologue:
Dpy30
Mouse Description:
dpy-30 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1913560]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19592 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19592
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024743 Essential Splice Site 17 106 2 5
ENSDART00000134065 Essential Splice Site 17 88 2 6
Genomic Location (Zv9):
Chromosome 1 (position 51549665)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50396544
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTACAGAACACACTGATGCCGGGGAGAGCATGGAGGGACACACTCCTG[T/C]AAGTATCATTAGTTGAAGATCATTTAAAGTAAGATAGTTTGCGTTTATCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link